Incidental Mutation 'R4977:Midn'
ID382784
Institutional Source Beutler Lab
Gene Symbol Midn
Ensembl Gene ENSMUSG00000035621
Gene Namemidnolin
Synonyms
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R4977 (G1)
Quality Score173
Status Not validated
Chromosome10
Chromosomal Location80148272-80158368 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80150184 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 36 (I36N)
Ref Sequence ENSEMBL: ENSMUSP00000097091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003156] [ENSMUST00000042057] [ENSMUST00000099492] [ENSMUST00000105366] [ENSMUST00000105367] [ENSMUST00000144526] [ENSMUST00000146516] [ENSMUST00000151202] [ENSMUST00000153477]
Predicted Effect probably benign
Transcript: ENSMUST00000003156
SMART Domains Protein: ENSMUSP00000003156
Gene: ENSMUSG00000003072

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:ATP-synt_DE_N 38 119 2.2e-21 PFAM
low complexity region 144 162 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000042057
AA Change: I36N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046967
Gene: ENSMUSG00000035621
AA Change: I36N

DomainStartEndE-ValueType
UBQ 32 102 3.39e-7 SMART
low complexity region 130 143 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
low complexity region 238 262 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 434 453 N/A INTRINSIC
low complexity region 465 485 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099492
AA Change: I36N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097091
Gene: ENSMUSG00000035621
AA Change: I36N

DomainStartEndE-ValueType
UBQ 32 102 3.39e-7 SMART
low complexity region 154 168 N/A INTRINSIC
low complexity region 195 219 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105366
SMART Domains Protein: ENSMUSP00000101005
Gene: ENSMUSG00000003072

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:ATP-synt_DE_N 38 103 2.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105367
SMART Domains Protein: ENSMUSP00000101006
Gene: ENSMUSG00000003072

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:ATP-synt_DE_N 38 119 2.2e-21 PFAM
low complexity region 144 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124179
Predicted Effect probably benign
Transcript: ENSMUST00000144526
SMART Domains Protein: ENSMUSP00000120988
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146516
SMART Domains Protein: ENSMUSP00000119962
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 88 112 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151202
AA Change: I36N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115717
Gene: ENSMUSG00000035621
AA Change: I36N

DomainStartEndE-ValueType
Blast:UBQ 32 67 4e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153477
SMART Domains Protein: ENSMUSP00000119787
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that contains an ubiquitin-like domain. This protein may be involved in the regulation of brain development as inferred by its high expression level in the embryonic midbrain. This protein has been found to negatively regulate glucokinase activity and insulin secretion in pancreatic beta cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate and small ovary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Midn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Midn APN 10 80156643 unclassified probably benign
IGL01969:Midn APN 10 80155259 missense probably benign 0.00
IGL02824:Midn APN 10 80153652 missense possibly damaging 0.91
Midnight UTSW 10 80154457 missense probably damaging 0.98
Sepia UTSW 10 80151404 missense probably null 0.26
R0684:Midn UTSW 10 80156502 missense probably damaging 1.00
R1517:Midn UTSW 10 80154123 missense probably damaging 0.96
R1926:Midn UTSW 10 80151661 missense probably damaging 1.00
R2004:Midn UTSW 10 80155149 missense probably benign 0.13
R2016:Midn UTSW 10 80150115 missense possibly damaging 0.91
R2340:Midn UTSW 10 80150112 missense possibly damaging 0.66
R2483:Midn UTSW 10 80150310 missense probably benign 0.16
R3622:Midn UTSW 10 80150310 missense probably benign 0.16
R3624:Midn UTSW 10 80150310 missense probably benign 0.16
R4296:Midn UTSW 10 80151719 missense probably damaging 1.00
R4740:Midn UTSW 10 80151404 missense probably null 0.26
R4930:Midn UTSW 10 80155355 missense probably benign
R5423:Midn UTSW 10 80155193 missense probably benign 0.15
R6149:Midn UTSW 10 80154457 missense probably damaging 0.98
R6542:Midn UTSW 10 80156584 missense probably damaging 0.97
R6826:Midn UTSW 10 80154127 nonsense probably null
R7478:Midn UTSW 10 80155322 missense possibly damaging 0.53
X0018:Midn UTSW 10 80153997 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGAGGACCTTGTTTCGGC -3'
(R):5'- GTATTTCCCGTGCACCCTGG -3'

Sequencing Primer
(F):5'- TTTCGGCGGGGGAGTCC -3'
(R):5'- GGCCCAAGCAAGTAAGGCC -3'
Posted On2016-04-27