Incidental Mutation 'R4977:Cep112'
ID382792
Institutional Source Beutler Lab
Gene Symbol Cep112
Ensembl Gene ENSMUSG00000020728
Gene Namecentrosomal protein 112
SynonymsMacoco, 8430407H02Rik, Ccdc46, 1700001M19Rik, 1700029K01Rik
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R4977 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location108425192-108860615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108434236 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 35 (S35P)
Ref Sequence ENSEMBL: ENSMUSP00000117192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061287] [ENSMUST00000130515] [ENSMUST00000138538] [ENSMUST00000149683] [ENSMUST00000150863] [ENSMUST00000182729]
Predicted Effect probably damaging
Transcript: ENSMUST00000061287
AA Change: S35P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050597
Gene: ENSMUSG00000020728
AA Change: S35P

DomainStartEndE-ValueType
Pfam:DUF4485 13 98 4.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130515
AA Change: S35P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114569
Gene: ENSMUSG00000020728
AA Change: S35P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138538
AA Change: S35P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117192
Gene: ENSMUSG00000020728
AA Change: S35P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.7e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143212
Predicted Effect probably benign
Transcript: ENSMUST00000149683
AA Change: S35P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114452
Gene: ENSMUSG00000020728
AA Change: S35P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150863
AA Change: S87P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122509
Gene: ENSMUSG00000020728
AA Change: S87P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.8e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 566 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182729
AA Change: S35P

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138235
Gene: ENSMUSG00000020728
AA Change: S35P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.4e-31 PFAM
coiled coil region 233 299 N/A INTRINSIC
coiled coil region 355 435 N/A INTRINSIC
coiled coil region 462 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein that belongs to the cell division control protein 42 effector protein family. In neurons, it localizes to the cytoplasm of dendrites and is also enriched in the nucleus where it interacts with the RNA polymerase III transcriptional repressor Maf1 to regulate gamma-aminobutyric acid A receptor surface expression. In addition, the protein has been identified as a component of the human centrosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Cep112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Cep112 APN 11 108591053 missense probably damaging 1.00
IGL00705:Cep112 APN 11 108472033 missense probably benign
IGL00848:Cep112 APN 11 108472060 missense probably damaging 1.00
IGL00975:Cep112 APN 11 108434186 missense probably damaging 1.00
IGL01085:Cep112 APN 11 108486606 missense probably damaging 1.00
IGL01286:Cep112 APN 11 108859409 critical splice donor site probably null
IGL01536:Cep112 APN 11 108531411 missense probably null 0.08
IGL02622:Cep112 APN 11 108518683 missense probably benign 0.26
IGL02720:Cep112 APN 11 108859351 missense probably damaging 0.98
FR4976:Cep112 UTSW 11 108425352 unclassified probably benign
PIT4466001:Cep112 UTSW 11 108519896 missense probably benign
R0727:Cep112 UTSW 11 108506554 missense probably damaging 1.00
R0907:Cep112 UTSW 11 108570432 splice site probably benign
R0908:Cep112 UTSW 11 108664497 missense possibly damaging 0.69
R1236:Cep112 UTSW 11 108859374 missense probably damaging 1.00
R1514:Cep112 UTSW 11 108472054 missense probably damaging 1.00
R2049:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2058:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2059:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2126:Cep112 UTSW 11 108508258 missense probably damaging 0.98
R2142:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2196:Cep112 UTSW 11 108570361 missense probably damaging 0.98
R2276:Cep112 UTSW 11 108855845 missense probably damaging 1.00
R2414:Cep112 UTSW 11 108752582 missense possibly damaging 0.91
R2655:Cep112 UTSW 11 108437201 splice site probably benign
R2882:Cep112 UTSW 11 108519212 missense possibly damaging 0.94
R3001:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3002:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3003:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R4407:Cep112 UTSW 11 108519201 missense possibly damaging 0.93
R4796:Cep112 UTSW 11 108486992 critical splice donor site probably null
R4898:Cep112 UTSW 11 108506645 missense probably damaging 0.96
R4899:Cep112 UTSW 11 108606284 missense probably damaging 0.96
R5021:Cep112 UTSW 11 108470328 missense possibly damaging 0.86
R5186:Cep112 UTSW 11 108752560 missense probably benign 0.00
R5462:Cep112 UTSW 11 108518744 missense probably damaging 1.00
R5494:Cep112 UTSW 11 108664605 missense probably damaging 1.00
R5506:Cep112 UTSW 11 108664603 missense probably damaging 1.00
R5560:Cep112 UTSW 11 108437235 missense probably damaging 1.00
R5682:Cep112 UTSW 11 108470312 missense probably damaging 1.00
R5857:Cep112 UTSW 11 108531471 splice site probably benign
R5863:Cep112 UTSW 11 108606232 missense probably damaging 1.00
R5884:Cep112 UTSW 11 108570316 missense probably damaging 0.99
R5913:Cep112 UTSW 11 108757688 missense probably damaging 0.99
R6344:Cep112 UTSW 11 108519174 missense probably damaging 0.98
R6498:Cep112 UTSW 11 108440531 missense probably benign 0.25
R6611:Cep112 UTSW 11 108506551 missense possibly damaging 0.71
R6638:Cep112 UTSW 11 108855870 missense probably damaging 1.00
R6916:Cep112 UTSW 11 108859376 missense probably damaging 1.00
R7182:Cep112 UTSW 11 108682844 missense probably benign 0.07
R7262:Cep112 UTSW 11 108664641 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACTGGTATTAATTGACAAGCTTC -3'
(R):5'- AGGACACATGACATGGCATCAC -3'

Sequencing Primer
(F):5'- TGGCTTTCCTCATACAGG -3'
(R):5'- CAGCTAGATATGCTGGTACATGCC -3'
Posted On2016-04-27