Incidental Mutation 'R4977:Olfr130'
ID382805
Institutional Source Beutler Lab
Gene Symbol Olfr130
Ensembl Gene ENSMUSG00000094878
Gene Nameolfactory receptor 130
SynonymsGA_x6K02T2PSCP-2515350-2516303, MOR256-19
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4977 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location38063921-38072790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38067747 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 192 (H192L)
Ref Sequence ENSEMBL: ENSMUSP00000149601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087129] [ENSMUST00000215726] [ENSMUST00000217390]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087129
AA Change: H192L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084369
Gene: ENSMUSG00000094878
AA Change: H192L

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.8e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 223 1.9e-5 PFAM
Pfam:7tm_1 40 289 1.9e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215726
AA Change: H192L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217390
AA Change: H192L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Olfr130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr130 APN 17 38068095 missense probably benign
IGL02158:Olfr130 APN 17 38067267 missense probably damaging 0.97
IGL03172:Olfr130 APN 17 38067384 missense probably damaging 0.99
R0389:Olfr130 UTSW 17 38067671 missense possibly damaging 0.58
R0448:Olfr130 UTSW 17 38067672 missense probably benign 0.00
R0616:Olfr130 UTSW 17 38067240 missense probably damaging 1.00
R0961:Olfr130 UTSW 17 38067923 missense probably damaging 1.00
R1789:Olfr130 UTSW 17 38067948 missense probably damaging 1.00
R2108:Olfr130 UTSW 17 38067855 missense possibly damaging 0.82
R4600:Olfr130 UTSW 17 38067962 missense probably damaging 0.99
R5120:Olfr130 UTSW 17 38067266 missense probably damaging 0.97
R5930:Olfr130 UTSW 17 38067750 missense probably benign 0.11
R6273:Olfr130 UTSW 17 38067795 missense probably damaging 1.00
R6636:Olfr130 UTSW 17 38067224 missense probably damaging 0.98
R6637:Olfr130 UTSW 17 38067224 missense probably damaging 0.98
R7030:Olfr130 UTSW 17 38068057 missense probably benign 0.13
R7045:Olfr130 UTSW 17 38067971 missense probably benign 0.01
R7175:Olfr130 UTSW 17 38067479 missense probably damaging 0.96
R7359:Olfr130 UTSW 17 38067615 nonsense probably null
X0019:Olfr130 UTSW 17 38067722 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTACAGTTATGCACCCACG -3'
(R):5'- GCATAGGAGCTGTTAGGCTG -3'

Sequencing Primer
(F):5'- AGTTATGCACCCACGGCTCTG -3'
(R):5'- GATATAGATAGCAGTGATTGTGCC -3'
Posted On2016-04-27