Incidental Mutation 'R4938:Mstn'
ID382809
Institutional Source Beutler Lab
Gene Symbol Mstn
Ensembl Gene ENSMUSG00000026100
Gene Namemyostatin
SynonymsGdf8
MMRRC Submission 042537-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R4938 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53061640-53068079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53066423 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 308 (N308S)
Ref Sequence ENSEMBL: ENSMUSP00000027269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027269] [ENSMUST00000191197]
PDB Structure
Crystal structure of the myostatin:follistatin 288 complex [X-RAY DIFFRACTION]
Crystal Structure of the Myostatin:Follistatin-like 3 Complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027269
AA Change: N308S

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027269
Gene: ENSMUSG00000026100
AA Change: N308S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 38 266 1.3e-30 PFAM
TGFB 282 376 2.31e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191197
SMART Domains Protein: ENSMUSP00000140249
Gene: ENSMUSG00000026100

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 13 188 1.3e-29 PFAM
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein negatively regulates skeletal muscle cell proliferation and differentiation. Homozygous knockout mice for this gene exhibit increased muscle mass and bone density, and reduced adiposity. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit markedly increased size of striated muscle due to both hyperplasia and hypertrophy, reduced adiposity, and increased bone mineral density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl14ep G T 2: 106,969,318 H59Q probably damaging Het
Atp6v0a4 T A 6: 38,078,814 I321F possibly damaging Het
Cdr2l A G 11: 115,393,825 D329G possibly damaging Het
Cep55 A G 19: 38,069,916 E319G probably damaging Het
Cfhr2 C T 1: 139,813,527 V237I probably benign Het
Clasrp A G 7: 19,584,778 probably null Het
Col12a1 C A 9: 79,700,350 E399* probably null Het
Cyp19a1 T A 9: 54,173,363 I237F probably benign Het
Dnajc6 T G 4: 101,636,813 N847K probably damaging Het
E330013P04Rik C G 19: 60,162,021 noncoding transcript Het
Entpd2 A G 2: 25,399,417 T304A probably benign Het
Etl4 A G 2: 20,798,649 T779A probably benign Het
Fam107b A T 2: 3,772,870 I35L probably benign Het
Fam196b G A 11: 34,402,231 G91E probably damaging Het
Fgg A T 3: 83,012,868 Y318F probably benign Het
Fitm1 A C 14: 55,576,619 T191P probably damaging Het
Fras1 A G 5: 96,776,724 M3675V probably damaging Het
Fry C T 5: 150,477,989 R731W probably damaging Het
Galnt17 A T 5: 131,306,399 S68T probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Grm1 C T 10: 10,936,513 A256T probably damaging Het
Hoxd13 A G 2: 74,668,683 Y125C probably benign Het
Hspa14 A T 2: 3,491,609 I373K probably benign Het
Ifnlr1 A G 4: 135,705,282 E343G probably benign Het
Ighv5-9 A G 12: 113,661,962 S54P probably benign Het
Irf2bpl A G 12: 86,882,118 S594P possibly damaging Het
Kcnq2 A G 2: 181,086,973 S548P probably damaging Het
Lrp2 G A 2: 69,472,368 R3006W probably damaging Het
Lrrc4c A T 2: 97,629,301 I91F probably damaging Het
Mdh1b T C 1: 63,711,504 D435G probably benign Het
Mettl3 A T 14: 52,299,727 S182T probably damaging Het
Mllt6 A G 11: 97,678,407 T862A probably benign Het
Mmp27 G T 9: 7,578,982 R412I probably damaging Het
Ncapg A G 5: 45,671,209 T101A probably benign Het
Ngf C T 3: 102,520,474 R180W probably damaging Het
Notch1 G A 2: 26,474,124 Q862* probably null Het
Nsrp1 T C 11: 77,045,744 D542G probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1444 T A 19: 12,862,552 M259K probably damaging Het
Olfr902 T A 9: 38,449,383 D170E probably benign Het
Papln C T 12: 83,782,903 P911S probably benign Het
Pdxdc1 A G 16: 13,876,069 V163A probably benign Het
Plekhj1 A T 10: 80,797,775 I76N probably damaging Het
Pnp2 A G 14: 50,963,568 probably null Het
Polr3gl T C 3: 96,579,892 E89G probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prss37 A G 6: 40,514,983 I221T possibly damaging Het
Ptx4 C T 17: 25,123,165 Q205* probably null Het
Qsox1 T C 1: 155,779,668 E583G probably benign Het
Riok3 T A 18: 12,155,243 N492K probably benign Het
Sec13 A G 6: 113,735,192 W61R probably damaging Het
Slc20a2 T C 8: 22,561,205 V418A possibly damaging Het
Smad9 G A 3: 54,789,230 V239I probably benign Het
Stmn2 A G 3: 8,545,732 E92G probably damaging Het
Taf1c A G 8: 119,598,798 V775A probably benign Het
Thsd7a T A 6: 12,330,992 I1384L probably benign Het
Tnxb A G 17: 34,713,632 Y2275C probably damaging Het
Trmo G T 4: 46,382,388 T243N probably benign Het
Tyrp1 C T 4: 80,840,646 A252V probably damaging Het
Vasp T C 7: 19,257,717 *376W probably null Het
Vmn1r231 T C 17: 20,890,351 I101V possibly damaging Het
Zfp532 T C 18: 65,623,766 S257P probably benign Het
Zfp563 G A 17: 33,105,709 C426Y probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp703 C A 8: 26,979,773 H488Q probably damaging Het
Zfp964 A G 8: 69,664,108 N452D possibly damaging Het
Zfyve28 A C 5: 34,233,354 Y188D probably damaging Het
Other mutations in Mstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Mstn APN 1 53061997 missense possibly damaging 0.47
IGL01432:Mstn APN 1 53066530 missense possibly damaging 0.65
IGL02009:Mstn APN 1 53062150 splice site probably benign
IGL02547:Mstn APN 1 53064125 missense probably benign 0.08
PIT4403001:Mstn UTSW 1 53061785 missense probably benign 0.00
R0499:Mstn UTSW 1 53063984 missense probably damaging 1.00
R0556:Mstn UTSW 1 53064125 missense probably benign 0.08
R0730:Mstn UTSW 1 53061794 missense possibly damaging 0.81
R1180:Mstn UTSW 1 53064008 missense possibly damaging 0.93
R1472:Mstn UTSW 1 53061998 missense probably damaging 0.99
R1659:Mstn UTSW 1 53064077 nonsense probably null
R1676:Mstn UTSW 1 53062065 missense probably benign 0.08
R1753:Mstn UTSW 1 53066558 missense probably damaging 1.00
R3852:Mstn UTSW 1 53061971 missense possibly damaging 0.78
R4773:Mstn UTSW 1 53062108 missense probably benign 0.18
R6000:Mstn UTSW 1 53061669 start gained probably benign
R6393:Mstn UTSW 1 53066489 missense probably benign 0.00
R6991:Mstn UTSW 1 53061941 missense probably benign 0.02
R7018:Mstn UTSW 1 53064084 missense possibly damaging 0.51
R7077:Mstn UTSW 1 53064249 missense probably benign 0.30
R7170:Mstn UTSW 1 53066395 missense probably damaging 1.00
R7300:Mstn UTSW 1 53064080 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGGAAGGATTTCAGGCTCTATTTAC -3'
(R):5'- ACTACCATGGCTGGAATTTTCC -3'

Sequencing Primer
(F):5'- TTCACACAGAATCCCTTTTTAGAAG -3'
(R):5'- GGAGACATTTTTGTCGGAGT -3'
Posted On2016-04-27