Incidental Mutation 'R4938:Qsox1'
ID382812
Institutional Source Beutler Lab
Gene Symbol Qsox1
Ensembl Gene ENSMUSG00000033684
Gene Namequiescin Q6 sulfhydryl oxidase 1
SynonymsQscn6, QSOX, 1300003H02Rik
MMRRC Submission 042537-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R4938 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location155776029-155812889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155779668 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 583 (E583G)
Ref Sequence ENSEMBL: ENSMUSP00000107394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035325] [ENSMUST00000111764] [ENSMUST00000194632]
Predicted Effect probably benign
Transcript: ENSMUST00000035325
AA Change: E583G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000035658
Gene: ENSMUSG00000033684
AA Change: E583G

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 46 149 9e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 507 7e-29 PFAM
low complexity region 679 692 N/A INTRINSIC
low complexity region 693 705 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111764
AA Change: E583G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107394
Gene: ENSMUSG00000033684
AA Change: E583G

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 45 149 1.7e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 508 1.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130701
Predicted Effect probably benign
Transcript: ENSMUST00000194632
SMART Domains Protein: ENSMUSP00000142301
Gene: ENSMUSG00000033684

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 45 149 1.3e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 508 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195419
Meta Mutation Damage Score 0.1048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that this gene plays an important role in growth regulation. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for an ENU-induced mutation show cardiovascular phenotypes including persistent truncus arteriosus, atriventricular septal defects and vascular ring, as well as eye defects, short snout, micrognathia, cleft palate, tracheosophageal fistula, polydactyly and spleen hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl14ep G T 2: 106,969,318 H59Q probably damaging Het
Atp6v0a4 T A 6: 38,078,814 I321F possibly damaging Het
Cdr2l A G 11: 115,393,825 D329G possibly damaging Het
Cep55 A G 19: 38,069,916 E319G probably damaging Het
Cfhr2 C T 1: 139,813,527 V237I probably benign Het
Clasrp A G 7: 19,584,778 probably null Het
Col12a1 C A 9: 79,700,350 E399* probably null Het
Cyp19a1 T A 9: 54,173,363 I237F probably benign Het
Dnajc6 T G 4: 101,636,813 N847K probably damaging Het
E330013P04Rik C G 19: 60,162,021 noncoding transcript Het
Entpd2 A G 2: 25,399,417 T304A probably benign Het
Etl4 A G 2: 20,798,649 T779A probably benign Het
Fam107b A T 2: 3,772,870 I35L probably benign Het
Fam196b G A 11: 34,402,231 G91E probably damaging Het
Fgg A T 3: 83,012,868 Y318F probably benign Het
Fitm1 A C 14: 55,576,619 T191P probably damaging Het
Fras1 A G 5: 96,776,724 M3675V probably damaging Het
Fry C T 5: 150,477,989 R731W probably damaging Het
Galnt17 A T 5: 131,306,399 S68T probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Grm1 C T 10: 10,936,513 A256T probably damaging Het
Hoxd13 A G 2: 74,668,683 Y125C probably benign Het
Hspa14 A T 2: 3,491,609 I373K probably benign Het
Ifnlr1 A G 4: 135,705,282 E343G probably benign Het
Ighv5-9 A G 12: 113,661,962 S54P probably benign Het
Irf2bpl A G 12: 86,882,118 S594P possibly damaging Het
Kcnq2 A G 2: 181,086,973 S548P probably damaging Het
Lrp2 G A 2: 69,472,368 R3006W probably damaging Het
Lrrc4c A T 2: 97,629,301 I91F probably damaging Het
Mdh1b T C 1: 63,711,504 D435G probably benign Het
Mettl3 A T 14: 52,299,727 S182T probably damaging Het
Mllt6 A G 11: 97,678,407 T862A probably benign Het
Mmp27 G T 9: 7,578,982 R412I probably damaging Het
Mstn A G 1: 53,066,423 N308S possibly damaging Het
Ncapg A G 5: 45,671,209 T101A probably benign Het
Ngf C T 3: 102,520,474 R180W probably damaging Het
Notch1 G A 2: 26,474,124 Q862* probably null Het
Nsrp1 T C 11: 77,045,744 D542G probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1444 T A 19: 12,862,552 M259K probably damaging Het
Olfr902 T A 9: 38,449,383 D170E probably benign Het
Papln C T 12: 83,782,903 P911S probably benign Het
Pdxdc1 A G 16: 13,876,069 V163A probably benign Het
Plekhj1 A T 10: 80,797,775 I76N probably damaging Het
Pnp2 A G 14: 50,963,568 probably null Het
Polr3gl T C 3: 96,579,892 E89G probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prss37 A G 6: 40,514,983 I221T possibly damaging Het
Ptx4 C T 17: 25,123,165 Q205* probably null Het
Riok3 T A 18: 12,155,243 N492K probably benign Het
Sec13 A G 6: 113,735,192 W61R probably damaging Het
Slc20a2 T C 8: 22,561,205 V418A possibly damaging Het
Smad9 G A 3: 54,789,230 V239I probably benign Het
Stmn2 A G 3: 8,545,732 E92G probably damaging Het
Taf1c A G 8: 119,598,798 V775A probably benign Het
Thsd7a T A 6: 12,330,992 I1384L probably benign Het
Tnxb A G 17: 34,713,632 Y2275C probably damaging Het
Trmo G T 4: 46,382,388 T243N probably benign Het
Tyrp1 C T 4: 80,840,646 A252V probably damaging Het
Vasp T C 7: 19,257,717 *376W probably null Het
Vmn1r231 T C 17: 20,890,351 I101V possibly damaging Het
Zfp532 T C 18: 65,623,766 S257P probably benign Het
Zfp563 G A 17: 33,105,709 C426Y probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp703 C A 8: 26,979,773 H488Q probably damaging Het
Zfp964 A G 8: 69,664,108 N452D possibly damaging Het
Zfyve28 A C 5: 34,233,354 Y188D probably damaging Het
Other mutations in Qsox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02392:Qsox1 APN 1 155812600 missense probably damaging 1.00
R1799:Qsox1 UTSW 1 155794618 missense probably null
R1833:Qsox1 UTSW 1 155791045 missense probably benign 0.15
R1874:Qsox1 UTSW 1 155812639 missense possibly damaging 0.85
R4282:Qsox1 UTSW 1 155786925 critical splice acceptor site probably null
R5081:Qsox1 UTSW 1 155812835 utr 5 prime probably benign
R5217:Qsox1 UTSW 1 155790996 missense probably benign 0.00
R5303:Qsox1 UTSW 1 155779293 missense probably benign 0.01
R5761:Qsox1 UTSW 1 155779528 missense probably benign
R5763:Qsox1 UTSW 1 155779879 missense probably benign
R5932:Qsox1 UTSW 1 155789333 missense probably benign
R6765:Qsox1 UTSW 1 155791105 missense probably benign 0.00
R6802:Qsox1 UTSW 1 155795393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGCTCAAGTGTTGCTGC -3'
(R):5'- TAATGAACTCAACGGACAGGTGC -3'

Sequencing Primer
(F):5'- AAGTGTTGCTGCCCGGG -3'
(R):5'- TCAACGGACAGGTGCCTTTG -3'
Posted On2016-04-27