Incidental Mutation 'R4938:Nup214'
ID382818
Institutional Source Beutler Lab
Gene Symbol Nup214
Ensembl Gene ENSMUSG00000001855
Gene Namenucleoporin 214
SynonymsCAN, D2H9S46E
MMRRC Submission 042537-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4938 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31974436-32053975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31983159 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 255 (T255K)
Ref Sequence ENSEMBL: ENSMUSP00000066492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065398]
Predicted Effect probably benign
Transcript: ENSMUST00000065398
AA Change: T255K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: T255K

DomainStartEndE-ValueType
WD40 138 178 2.48e0 SMART
WD40 182 220 2.67e-1 SMART
low complexity region 428 441 N/A INTRINSIC
low complexity region 449 467 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
low complexity region 529 546 N/A INTRINSIC
low complexity region 620 640 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
coiled coil region 853 881 N/A INTRINSIC
internal_repeat_1 969 993 1.13e-9 PROSPERO
internal_repeat_1 985 1009 1.13e-9 PROSPERO
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1093 1111 N/A INTRINSIC
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1226 1248 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1391 1426 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1458 1505 N/A INTRINSIC
low complexity region 1559 1573 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1658 1670 N/A INTRINSIC
low complexity region 1686 1715 N/A INTRINSIC
low complexity region 1733 1748 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
low complexity region 1799 1832 N/A INTRINSIC
low complexity region 1853 1872 N/A INTRINSIC
low complexity region 1877 1886 N/A INTRINSIC
low complexity region 1898 1910 N/A INTRINSIC
low complexity region 1925 1934 N/A INTRINSIC
low complexity region 1969 1995 N/A INTRINSIC
low complexity region 2007 2032 N/A INTRINSIC
low complexity region 2048 2076 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130975
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl14ep G T 2: 106,969,318 H59Q probably damaging Het
Atp6v0a4 T A 6: 38,078,814 I321F possibly damaging Het
Cdr2l A G 11: 115,393,825 D329G possibly damaging Het
Cep55 A G 19: 38,069,916 E319G probably damaging Het
Cfhr2 C T 1: 139,813,527 V237I probably benign Het
Clasrp A G 7: 19,584,778 probably null Het
Col12a1 C A 9: 79,700,350 E399* probably null Het
Cyp19a1 T A 9: 54,173,363 I237F probably benign Het
Dnajc6 T G 4: 101,636,813 N847K probably damaging Het
E330013P04Rik C G 19: 60,162,021 noncoding transcript Het
Entpd2 A G 2: 25,399,417 T304A probably benign Het
Etl4 A G 2: 20,798,649 T779A probably benign Het
Fam107b A T 2: 3,772,870 I35L probably benign Het
Fam196b G A 11: 34,402,231 G91E probably damaging Het
Fgg A T 3: 83,012,868 Y318F probably benign Het
Fitm1 A C 14: 55,576,619 T191P probably damaging Het
Fras1 A G 5: 96,776,724 M3675V probably damaging Het
Fry C T 5: 150,477,989 R731W probably damaging Het
Galnt17 A T 5: 131,306,399 S68T probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Grm1 C T 10: 10,936,513 A256T probably damaging Het
Hoxd13 A G 2: 74,668,683 Y125C probably benign Het
Hspa14 A T 2: 3,491,609 I373K probably benign Het
Ifnlr1 A G 4: 135,705,282 E343G probably benign Het
Ighv5-9 A G 12: 113,661,962 S54P probably benign Het
Irf2bpl A G 12: 86,882,118 S594P possibly damaging Het
Kcnq2 A G 2: 181,086,973 S548P probably damaging Het
Lrp2 G A 2: 69,472,368 R3006W probably damaging Het
Lrrc4c A T 2: 97,629,301 I91F probably damaging Het
Mdh1b T C 1: 63,711,504 D435G probably benign Het
Mettl3 A T 14: 52,299,727 S182T probably damaging Het
Mllt6 A G 11: 97,678,407 T862A probably benign Het
Mmp27 G T 9: 7,578,982 R412I probably damaging Het
Mstn A G 1: 53,066,423 N308S possibly damaging Het
Ncapg A G 5: 45,671,209 T101A probably benign Het
Ngf C T 3: 102,520,474 R180W probably damaging Het
Notch1 G A 2: 26,474,124 Q862* probably null Het
Nsrp1 T C 11: 77,045,744 D542G probably damaging Het
Olfr1444 T A 19: 12,862,552 M259K probably damaging Het
Olfr902 T A 9: 38,449,383 D170E probably benign Het
Papln C T 12: 83,782,903 P911S probably benign Het
Pdxdc1 A G 16: 13,876,069 V163A probably benign Het
Plekhj1 A T 10: 80,797,775 I76N probably damaging Het
Pnp2 A G 14: 50,963,568 probably null Het
Polr3gl T C 3: 96,579,892 E89G probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prss37 A G 6: 40,514,983 I221T possibly damaging Het
Ptx4 C T 17: 25,123,165 Q205* probably null Het
Qsox1 T C 1: 155,779,668 E583G probably benign Het
Riok3 T A 18: 12,155,243 N492K probably benign Het
Sec13 A G 6: 113,735,192 W61R probably damaging Het
Slc20a2 T C 8: 22,561,205 V418A possibly damaging Het
Smad9 G A 3: 54,789,230 V239I probably benign Het
Stmn2 A G 3: 8,545,732 E92G probably damaging Het
Taf1c A G 8: 119,598,798 V775A probably benign Het
Thsd7a T A 6: 12,330,992 I1384L probably benign Het
Tnxb A G 17: 34,713,632 Y2275C probably damaging Het
Trmo G T 4: 46,382,388 T243N probably benign Het
Tyrp1 C T 4: 80,840,646 A252V probably damaging Het
Vasp T C 7: 19,257,717 *376W probably null Het
Vmn1r231 T C 17: 20,890,351 I101V possibly damaging Het
Zfp532 T C 18: 65,623,766 S257P probably benign Het
Zfp563 G A 17: 33,105,709 C426Y probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp703 C A 8: 26,979,773 H488Q probably damaging Het
Zfp964 A G 8: 69,664,108 N452D possibly damaging Het
Zfyve28 A C 5: 34,233,354 Y188D probably damaging Het
Other mutations in Nup214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nup214 APN 2 32033979 missense probably damaging 1.00
IGL00649:Nup214 APN 2 32006721 missense probably benign 0.27
IGL01149:Nup214 APN 2 32034700 missense probably damaging 1.00
IGL01360:Nup214 APN 2 32038178 unclassified probably benign
IGL01409:Nup214 APN 2 32026931 splice site probably null
IGL01530:Nup214 APN 2 32033721 missense probably benign
IGL01554:Nup214 APN 2 32051072 nonsense probably null
IGL01944:Nup214 APN 2 32034959 nonsense probably null
IGL02296:Nup214 APN 2 31988188 missense possibly damaging 0.65
IGL02563:Nup214 APN 2 31977860 missense probably damaging 1.00
IGL02688:Nup214 APN 2 32031275 missense probably benign
IGL02858:Nup214 APN 2 32010372 splice site probably benign
IGL02953:Nup214 APN 2 31988229 missense possibly damaging 0.87
IGL03090:Nup214 APN 2 32018242 missense probably benign 0.01
IGL03124:Nup214 APN 2 31996440 missense probably benign 0.27
IGL03225:Nup214 APN 2 32034411 missense probably damaging 1.00
IGL03375:Nup214 APN 2 32010221 missense probably damaging 0.97
Des_moines UTSW 2 31980584 splice site probably null
ANU74:Nup214 UTSW 2 32034966 missense probably damaging 0.99
R0035:Nup214 UTSW 2 31990367 splice site probably null
R0243:Nup214 UTSW 2 31998057 splice site probably benign
R0270:Nup214 UTSW 2 32034814 missense probably damaging 0.96
R0358:Nup214 UTSW 2 32004300 splice site probably null
R1168:Nup214 UTSW 2 32025301 missense probably benign
R1242:Nup214 UTSW 2 31977770 missense probably benign 0.00
R1481:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1482:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1579:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1580:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1581:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1610:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1894:Nup214 UTSW 2 31996380 missense possibly damaging 0.66
R2146:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R2149:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R2293:Nup214 UTSW 2 32026875 missense probably benign
R2924:Nup214 UTSW 2 31998003 missense probably damaging 1.00
R2925:Nup214 UTSW 2 31998003 missense probably damaging 1.00
R3037:Nup214 UTSW 2 31976620 missense probably benign 0.00
R3426:Nup214 UTSW 2 32033403 missense probably damaging 0.97
R3799:Nup214 UTSW 2 32034682 missense probably damaging 1.00
R3843:Nup214 UTSW 2 32051100 missense probably damaging 1.00
R4323:Nup214 UTSW 2 31994684 missense probably benign
R4353:Nup214 UTSW 2 31977917 critical splice donor site probably null
R4601:Nup214 UTSW 2 31997965 missense probably benign 0.36
R4626:Nup214 UTSW 2 32033404 missense possibly damaging 0.92
R4874:Nup214 UTSW 2 31980584 splice site probably null
R4939:Nup214 UTSW 2 31983159 missense probably benign 0.00
R5027:Nup214 UTSW 2 31991317 missense probably damaging 1.00
R5358:Nup214 UTSW 2 32017146 missense unknown
R5406:Nup214 UTSW 2 32002607 missense probably damaging 0.96
R5507:Nup214 UTSW 2 31988176 missense possibly damaging 0.87
R5695:Nup214 UTSW 2 32034373 missense probably damaging 1.00
R5744:Nup214 UTSW 2 32010296 missense probably damaging 0.97
R5908:Nup214 UTSW 2 31991341 missense probably benign 0.03
R5967:Nup214 UTSW 2 31979778 missense possibly damaging 0.52
R6140:Nup214 UTSW 2 32051796 missense possibly damaging 0.92
R6243:Nup214 UTSW 2 32002932 missense possibly damaging 0.81
R6488:Nup214 UTSW 2 31991372 missense possibly damaging 0.93
R6934:Nup214 UTSW 2 31982671 nonsense probably null
R6970:Nup214 UTSW 2 32051798 missense probably damaging 1.00
R7028:Nup214 UTSW 2 32034156 missense probably benign 0.22
R7114:Nup214 UTSW 2 32025244 missense possibly damaging 0.83
R7120:Nup214 UTSW 2 32051042 missense probably benign 0.07
R7249:Nup214 UTSW 2 31988233 missense possibly damaging 0.92
X0026:Nup214 UTSW 2 32020306 missense possibly damaging 0.46
X0065:Nup214 UTSW 2 32042476 missense probably damaging 1.00
Z1088:Nup214 UTSW 2 32011223 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGATAGACCTTTGGTAAAGCCATAG -3'
(R):5'- GAAACCTTACCCCTGAGTCTAC -3'

Sequencing Primer
(F):5'- TTGTAGCACATGGTGGCT -3'
(R):5'- TGAGTCTACCATCACAGCTACTAAGG -3'
Posted On2016-04-27