Incidental Mutation 'R4938:Stmn2'
ID382824
Institutional Source Beutler Lab
Gene Symbol Stmn2
Ensembl Gene ENSMUSG00000027500
Gene Namestathmin-like 2
SynonymsScgn10, SCG10
MMRRC Submission 042537-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R4938 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location8509360-8561606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8545732 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 92 (E92G)
Ref Sequence ENSEMBL: ENSMUSP00000029002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029002]
Predicted Effect probably damaging
Transcript: ENSMUST00000029002
AA Change: E92G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029002
Gene: ENSMUSG00000027500
AA Change: E92G

DomainStartEndE-ValueType
Pfam:Stathmin 41 174 3.7e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194905
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the stathmin family of phosphoproteins. Stathmin proteins function in microtubule dynamics and signal transduction. The encoded protein plays a regulatory role in neuronal growth and is also thought to be involved in osteogenesis. Reductions in the expression of this gene have been associated with Down's syndrome and Alzheimer's disease. Alternatively spliced transcript variants have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl14ep G T 2: 106,969,318 H59Q probably damaging Het
Atp6v0a4 T A 6: 38,078,814 I321F possibly damaging Het
Cdr2l A G 11: 115,393,825 D329G possibly damaging Het
Cep55 A G 19: 38,069,916 E319G probably damaging Het
Cfhr2 C T 1: 139,813,527 V237I probably benign Het
Clasrp A G 7: 19,584,778 probably null Het
Col12a1 C A 9: 79,700,350 E399* probably null Het
Cyp19a1 T A 9: 54,173,363 I237F probably benign Het
Dnajc6 T G 4: 101,636,813 N847K probably damaging Het
E330013P04Rik C G 19: 60,162,021 noncoding transcript Het
Entpd2 A G 2: 25,399,417 T304A probably benign Het
Etl4 A G 2: 20,798,649 T779A probably benign Het
Fam107b A T 2: 3,772,870 I35L probably benign Het
Fam196b G A 11: 34,402,231 G91E probably damaging Het
Fgg A T 3: 83,012,868 Y318F probably benign Het
Fitm1 A C 14: 55,576,619 T191P probably damaging Het
Fras1 A G 5: 96,776,724 M3675V probably damaging Het
Fry C T 5: 150,477,989 R731W probably damaging Het
Galnt17 A T 5: 131,306,399 S68T probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Grm1 C T 10: 10,936,513 A256T probably damaging Het
Hoxd13 A G 2: 74,668,683 Y125C probably benign Het
Hspa14 A T 2: 3,491,609 I373K probably benign Het
Ifnlr1 A G 4: 135,705,282 E343G probably benign Het
Ighv5-9 A G 12: 113,661,962 S54P probably benign Het
Irf2bpl A G 12: 86,882,118 S594P possibly damaging Het
Kcnq2 A G 2: 181,086,973 S548P probably damaging Het
Lrp2 G A 2: 69,472,368 R3006W probably damaging Het
Lrrc4c A T 2: 97,629,301 I91F probably damaging Het
Mdh1b T C 1: 63,711,504 D435G probably benign Het
Mettl3 A T 14: 52,299,727 S182T probably damaging Het
Mllt6 A G 11: 97,678,407 T862A probably benign Het
Mmp27 G T 9: 7,578,982 R412I probably damaging Het
Mstn A G 1: 53,066,423 N308S possibly damaging Het
Ncapg A G 5: 45,671,209 T101A probably benign Het
Ngf C T 3: 102,520,474 R180W probably damaging Het
Notch1 G A 2: 26,474,124 Q862* probably null Het
Nsrp1 T C 11: 77,045,744 D542G probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1444 T A 19: 12,862,552 M259K probably damaging Het
Olfr902 T A 9: 38,449,383 D170E probably benign Het
Papln C T 12: 83,782,903 P911S probably benign Het
Pdxdc1 A G 16: 13,876,069 V163A probably benign Het
Plekhj1 A T 10: 80,797,775 I76N probably damaging Het
Pnp2 A G 14: 50,963,568 probably null Het
Polr3gl T C 3: 96,579,892 E89G probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prss37 A G 6: 40,514,983 I221T possibly damaging Het
Ptx4 C T 17: 25,123,165 Q205* probably null Het
Qsox1 T C 1: 155,779,668 E583G probably benign Het
Riok3 T A 18: 12,155,243 N492K probably benign Het
Sec13 A G 6: 113,735,192 W61R probably damaging Het
Slc20a2 T C 8: 22,561,205 V418A possibly damaging Het
Smad9 G A 3: 54,789,230 V239I probably benign Het
Taf1c A G 8: 119,598,798 V775A probably benign Het
Thsd7a T A 6: 12,330,992 I1384L probably benign Het
Tnxb A G 17: 34,713,632 Y2275C probably damaging Het
Trmo G T 4: 46,382,388 T243N probably benign Het
Tyrp1 C T 4: 80,840,646 A252V probably damaging Het
Vasp T C 7: 19,257,717 *376W probably null Het
Vmn1r231 T C 17: 20,890,351 I101V possibly damaging Het
Zfp532 T C 18: 65,623,766 S257P probably benign Het
Zfp563 G A 17: 33,105,709 C426Y probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp703 C A 8: 26,979,773 H488Q probably damaging Het
Zfp964 A G 8: 69,664,108 N452D possibly damaging Het
Zfyve28 A C 5: 34,233,354 Y188D probably damaging Het
Other mutations in Stmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Stmn2 APN 3 8560261 splice site probably benign
R0362:Stmn2 UTSW 3 8545690 missense probably damaging 0.99
R1885:Stmn2 UTSW 3 8541904 missense probably damaging 1.00
R1927:Stmn2 UTSW 3 8545576 missense probably benign 0.00
R2261:Stmn2 UTSW 3 8541895 missense probably damaging 0.97
R2262:Stmn2 UTSW 3 8541895 missense probably damaging 0.97
R2901:Stmn2 UTSW 3 8541921 missense probably benign
R4066:Stmn2 UTSW 3 8509608 utr 5 prime probably benign
R5191:Stmn2 UTSW 3 8545575 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGTTCCTTCCACAGACATG -3'
(R):5'- AGGCTCACTCAGGTACCATTG -3'

Sequencing Primer
(F):5'- TCCACAGACATGGAGGTGAAGC -3'
(R):5'- AAACCTGTGACTTTGAGGCC -3'
Posted On2016-04-27