Incidental Mutation 'R4938:Smad9'
ID382825
Institutional Source Beutler Lab
Gene Symbol Smad9
Ensembl Gene ENSMUSG00000027796
Gene NameSMAD family member 9
SynonymsSMAD8A, MADH6, SMAD8B, Madh9
MMRRC Submission 042537-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4938 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54755582-54801257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54789230 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 239 (V239I)
Ref Sequence ENSEMBL: ENSMUSP00000029371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029371]
Predicted Effect probably benign
Transcript: ENSMUST00000029371
AA Change: V239I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029371
Gene: ENSMUSG00000027796
AA Change: V239I

DomainStartEndE-ValueType
DWA 29 138 3.47e-68 SMART
DWB 234 406 1.02e-106 SMART
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that act as downstream effectors of the bone morphogenetic protein (BMP) signaling pathway. The encoded protein is phosphorylated by BMP receptors, which stimulates its binding to SMAD4 and translocation into the nucleus, where it functions as a regulator of transcription. Activity of this protein is important for embryonic development. Mutation of this gene results in defects in pulmonary vasculature. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice in which exon 3 was deleted are viable and fertile. Mutant mice in which a neo cassette is inserted in exon 3 resulting in a hypomorphic allele exhibit reduced midbrain and hindbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl14ep G T 2: 106,969,318 H59Q probably damaging Het
Atp6v0a4 T A 6: 38,078,814 I321F possibly damaging Het
Cdr2l A G 11: 115,393,825 D329G possibly damaging Het
Cep55 A G 19: 38,069,916 E319G probably damaging Het
Cfhr2 C T 1: 139,813,527 V237I probably benign Het
Clasrp A G 7: 19,584,778 probably null Het
Col12a1 C A 9: 79,700,350 E399* probably null Het
Cyp19a1 T A 9: 54,173,363 I237F probably benign Het
Dnajc6 T G 4: 101,636,813 N847K probably damaging Het
E330013P04Rik C G 19: 60,162,021 noncoding transcript Het
Entpd2 A G 2: 25,399,417 T304A probably benign Het
Etl4 A G 2: 20,798,649 T779A probably benign Het
Fam107b A T 2: 3,772,870 I35L probably benign Het
Fam196b G A 11: 34,402,231 G91E probably damaging Het
Fgg A T 3: 83,012,868 Y318F probably benign Het
Fitm1 A C 14: 55,576,619 T191P probably damaging Het
Fras1 A G 5: 96,776,724 M3675V probably damaging Het
Fry C T 5: 150,477,989 R731W probably damaging Het
Galnt17 A T 5: 131,306,399 S68T probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Grm1 C T 10: 10,936,513 A256T probably damaging Het
Hoxd13 A G 2: 74,668,683 Y125C probably benign Het
Hspa14 A T 2: 3,491,609 I373K probably benign Het
Ifnlr1 A G 4: 135,705,282 E343G probably benign Het
Ighv5-9 A G 12: 113,661,962 S54P probably benign Het
Irf2bpl A G 12: 86,882,118 S594P possibly damaging Het
Kcnq2 A G 2: 181,086,973 S548P probably damaging Het
Lrp2 G A 2: 69,472,368 R3006W probably damaging Het
Lrrc4c A T 2: 97,629,301 I91F probably damaging Het
Mdh1b T C 1: 63,711,504 D435G probably benign Het
Mettl3 A T 14: 52,299,727 S182T probably damaging Het
Mllt6 A G 11: 97,678,407 T862A probably benign Het
Mmp27 G T 9: 7,578,982 R412I probably damaging Het
Mstn A G 1: 53,066,423 N308S possibly damaging Het
Ncapg A G 5: 45,671,209 T101A probably benign Het
Ngf C T 3: 102,520,474 R180W probably damaging Het
Notch1 G A 2: 26,474,124 Q862* probably null Het
Nsrp1 T C 11: 77,045,744 D542G probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1444 T A 19: 12,862,552 M259K probably damaging Het
Olfr902 T A 9: 38,449,383 D170E probably benign Het
Papln C T 12: 83,782,903 P911S probably benign Het
Pdxdc1 A G 16: 13,876,069 V163A probably benign Het
Plekhj1 A T 10: 80,797,775 I76N probably damaging Het
Pnp2 A G 14: 50,963,568 probably null Het
Polr3gl T C 3: 96,579,892 E89G probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prss37 A G 6: 40,514,983 I221T possibly damaging Het
Ptx4 C T 17: 25,123,165 Q205* probably null Het
Qsox1 T C 1: 155,779,668 E583G probably benign Het
Riok3 T A 18: 12,155,243 N492K probably benign Het
Sec13 A G 6: 113,735,192 W61R probably damaging Het
Slc20a2 T C 8: 22,561,205 V418A possibly damaging Het
Stmn2 A G 3: 8,545,732 E92G probably damaging Het
Taf1c A G 8: 119,598,798 V775A probably benign Het
Thsd7a T A 6: 12,330,992 I1384L probably benign Het
Tnxb A G 17: 34,713,632 Y2275C probably damaging Het
Trmo G T 4: 46,382,388 T243N probably benign Het
Tyrp1 C T 4: 80,840,646 A252V probably damaging Het
Vasp T C 7: 19,257,717 *376W probably null Het
Vmn1r231 T C 17: 20,890,351 I101V possibly damaging Het
Zfp532 T C 18: 65,623,766 S257P probably benign Het
Zfp563 G A 17: 33,105,709 C426Y probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp703 C A 8: 26,979,773 H488Q probably damaging Het
Zfp964 A G 8: 69,664,108 N452D possibly damaging Het
Zfyve28 A C 5: 34,233,354 Y188D probably damaging Het
Other mutations in Smad9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Smad9 APN 3 54786172 missense possibly damaging 0.95
IGL02666:Smad9 APN 3 54782467 missense probably damaging 1.00
IGL03346:Smad9 APN 3 54789215 missense probably benign
R1839:Smad9 UTSW 3 54789179 splice site probably benign
R1888:Smad9 UTSW 3 54789179 splice site probably benign
R3622:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3623:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3624:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3708:Smad9 UTSW 3 54786181 missense probably benign
R4469:Smad9 UTSW 3 54782761 missense probably damaging 1.00
R4756:Smad9 UTSW 3 54794453 missense possibly damaging 0.50
R5139:Smad9 UTSW 3 54797406 missense possibly damaging 0.94
R5783:Smad9 UTSW 3 54794442 missense probably benign 0.15
R6200:Smad9 UTSW 3 54789186 missense probably benign
R6437:Smad9 UTSW 3 54786084 missense probably benign 0.33
R6478:Smad9 UTSW 3 54782443 missense probably damaging 1.00
R6552:Smad9 UTSW 3 54782746 missense probably damaging 1.00
R7058:Smad9 UTSW 3 54786193 missense probably benign 0.01
R7314:Smad9 UTSW 3 54789323 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACTGCAAAGGTCCTACAG -3'
(R):5'- TAGCAGGCTTCTTGGAGCTC -3'

Sequencing Primer
(F):5'- GACTGCAAAGGTCCTACAGTTCTC -3'
(R):5'- CAGGCTTCTTGGAGCTCAGAAG -3'
Posted On2016-04-27