Incidental Mutation 'R4938:Ngf'
ID382829
Institutional Source Beutler Lab
Gene Symbol Ngf
Ensembl Gene ENSMUSG00000027859
Gene Namenerve growth factor
SynonymsNgfb
MMRRC Submission 042537-MU
Accession Numbers

Ncbi RefSeq: NM_013609.2, NM_001112698.1; MGI:97321

Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R4938 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location102469919-102521013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102520474 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 180 (R180W)
Ref Sequence ENSEMBL: ENSMUSP00000142801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035952] [ENSMUST00000106925] [ENSMUST00000198644]
Predicted Effect probably damaging
Transcript: ENSMUST00000035952
AA Change: R118W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040345
Gene: ENSMUSG00000027859
AA Change: R118W

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
NGF 128 232 1.41e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106925
AA Change: R184W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102538
Gene: ENSMUSG00000027859
AA Change: R184W

DomainStartEndE-ValueType
NGF 194 298 1.41e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198644
AA Change: R180W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142801
Gene: ENSMUSG00000027859
AA Change: R180W

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
NGF 190 294 7.1e-81 SMART
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 99% (74/75)
MGI Phenotype Strain: 1857535
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit elevated pain threshold, loss of neurons in both sensory and sympathetic ganglia, but diminished apoptosis in the retina and spinal cord. Heterozygotes exhibit a substantially reduced number of sympathetic neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl14ep G T 2: 106,969,318 H59Q probably damaging Het
Atp6v0a4 T A 6: 38,078,814 I321F possibly damaging Het
Cdr2l A G 11: 115,393,825 D329G possibly damaging Het
Cep55 A G 19: 38,069,916 E319G probably damaging Het
Cfhr2 C T 1: 139,813,527 V237I probably benign Het
Clasrp A G 7: 19,584,778 probably null Het
Col12a1 C A 9: 79,700,350 E399* probably null Het
Cyp19a1 T A 9: 54,173,363 I237F probably benign Het
Dnajc6 T G 4: 101,636,813 N847K probably damaging Het
E330013P04Rik C G 19: 60,162,021 noncoding transcript Het
Entpd2 A G 2: 25,399,417 T304A probably benign Het
Etl4 A G 2: 20,798,649 T779A probably benign Het
Fam107b A T 2: 3,772,870 I35L probably benign Het
Fam196b G A 11: 34,402,231 G91E probably damaging Het
Fgg A T 3: 83,012,868 Y318F probably benign Het
Fitm1 A C 14: 55,576,619 T191P probably damaging Het
Fras1 A G 5: 96,776,724 M3675V probably damaging Het
Fry C T 5: 150,477,989 R731W probably damaging Het
Galnt17 A T 5: 131,306,399 S68T probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Grm1 C T 10: 10,936,513 A256T probably damaging Het
Hoxd13 A G 2: 74,668,683 Y125C probably benign Het
Hspa14 A T 2: 3,491,609 I373K probably benign Het
Ifnlr1 A G 4: 135,705,282 E343G probably benign Het
Ighv5-9 A G 12: 113,661,962 S54P probably benign Het
Irf2bpl A G 12: 86,882,118 S594P possibly damaging Het
Kcnq2 A G 2: 181,086,973 S548P probably damaging Het
Lrp2 G A 2: 69,472,368 R3006W probably damaging Het
Lrrc4c A T 2: 97,629,301 I91F probably damaging Het
Mdh1b T C 1: 63,711,504 D435G probably benign Het
Mettl3 A T 14: 52,299,727 S182T probably damaging Het
Mllt6 A G 11: 97,678,407 T862A probably benign Het
Mmp27 G T 9: 7,578,982 R412I probably damaging Het
Mstn A G 1: 53,066,423 N308S possibly damaging Het
Ncapg A G 5: 45,671,209 T101A probably benign Het
Notch1 G A 2: 26,474,124 Q862* probably null Het
Nsrp1 T C 11: 77,045,744 D542G probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1444 T A 19: 12,862,552 M259K probably damaging Het
Olfr902 T A 9: 38,449,383 D170E probably benign Het
Papln C T 12: 83,782,903 P911S probably benign Het
Pdxdc1 A G 16: 13,876,069 V163A probably benign Het
Plekhj1 A T 10: 80,797,775 I76N probably damaging Het
Pnp2 A G 14: 50,963,568 probably null Het
Polr3gl T C 3: 96,579,892 E89G probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prss37 A G 6: 40,514,983 I221T possibly damaging Het
Ptx4 C T 17: 25,123,165 Q205* probably null Het
Qsox1 T C 1: 155,779,668 E583G probably benign Het
Riok3 T A 18: 12,155,243 N492K probably benign Het
Sec13 A G 6: 113,735,192 W61R probably damaging Het
Slc20a2 T C 8: 22,561,205 V418A possibly damaging Het
Smad9 G A 3: 54,789,230 V239I probably benign Het
Stmn2 A G 3: 8,545,732 E92G probably damaging Het
Taf1c A G 8: 119,598,798 V775A probably benign Het
Thsd7a T A 6: 12,330,992 I1384L probably benign Het
Tnxb A G 17: 34,713,632 Y2275C probably damaging Het
Trmo G T 4: 46,382,388 T243N probably benign Het
Tyrp1 C T 4: 80,840,646 A252V probably damaging Het
Vasp T C 7: 19,257,717 *376W probably null Het
Vmn1r231 T C 17: 20,890,351 I101V possibly damaging Het
Zfp532 T C 18: 65,623,766 S257P probably benign Het
Zfp563 G A 17: 33,105,709 C426Y probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp703 C A 8: 26,979,773 H488Q probably damaging Het
Zfp964 A G 8: 69,664,108 N452D possibly damaging Het
Zfyve28 A C 5: 34,233,354 Y188D probably damaging Het
Other mutations in Ngf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Ngf APN 3 102520472 missense probably damaging 0.99
IGL01344:Ngf APN 3 102520312 missense probably benign 0.00
R0049:Ngf UTSW 3 102520345 nonsense probably null
R0049:Ngf UTSW 3 102520345 nonsense probably null
R0147:Ngf UTSW 3 102509803 intron probably benign
R0148:Ngf UTSW 3 102509803 intron probably benign
R0149:Ngf UTSW 3 102520446 missense probably benign 0.13
R1769:Ngf UTSW 3 102520197 missense possibly damaging 0.87
R4357:Ngf UTSW 3 102520205 missense probably benign 0.22
R4486:Ngf UTSW 3 102520699 missense probably damaging 1.00
R4487:Ngf UTSW 3 102520699 missense probably damaging 1.00
R4488:Ngf UTSW 3 102520699 missense probably damaging 1.00
R4817:Ngf UTSW 3 102509840 intron probably benign
R4883:Ngf UTSW 3 102520645 missense probably damaging 1.00
R5158:Ngf UTSW 3 102520129 missense possibly damaging 0.82
R5681:Ngf UTSW 3 102520353 missense probably damaging 1.00
R6259:Ngf UTSW 3 102509797 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCCTACTGCACCAATAGCTG -3'
(R):5'- ACTCTCAACAGGATTGGAGGCTC -3'

Sequencing Primer
(F):5'- CAATAGCTGCCCGAGTGACAG -3'
(R):5'- ATTGGAGGCTCGGCACTTG -3'
Posted On2016-04-27