Incidental Mutation 'R4938:Tyrp1'
ID382831
Institutional Source Beutler Lab
Gene Symbol Tyrp1
Ensembl Gene ENSMUSG00000005994
Gene Nametyrosinase-related protein 1
SynonymsTyrp, isa, Oca3, TRP1, TRP-1
MMRRC Submission 042537-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R4938 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location80834123-80851719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80840646 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 252 (A252V)
Ref Sequence ENSEMBL: ENSMUSP00000099895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006151] [ENSMUST00000102831] [ENSMUST00000133655]
Predicted Effect probably damaging
Transcript: ENSMUST00000006151
AA Change: A252V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006151
Gene: ENSMUSG00000005994
AA Change: A252V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 1.7e-37 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102831
AA Change: A252V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099895
Gene: ENSMUSG00000005994
AA Change: A252V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 4.9e-38 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133655
SMART Domains Protein: ENSMUSP00000117080
Gene: ENSMUSG00000005994

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 229 1.1e-7 PFAM
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Defects in this gene are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. [provided by RefSeq, Mar 2009]
PHENOTYPE: The major influence of mutations at this locus is to change eumelanin from a black to a brown pigment in the coat and eyes in varying degrees. Semidominant mutants result in melanocyte degeneration causing reduced pigmentation and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl14ep G T 2: 106,969,318 H59Q probably damaging Het
Atp6v0a4 T A 6: 38,078,814 I321F possibly damaging Het
Cdr2l A G 11: 115,393,825 D329G possibly damaging Het
Cep55 A G 19: 38,069,916 E319G probably damaging Het
Cfhr2 C T 1: 139,813,527 V237I probably benign Het
Clasrp A G 7: 19,584,778 probably null Het
Col12a1 C A 9: 79,700,350 E399* probably null Het
Cyp19a1 T A 9: 54,173,363 I237F probably benign Het
Dnajc6 T G 4: 101,636,813 N847K probably damaging Het
E330013P04Rik C G 19: 60,162,021 noncoding transcript Het
Entpd2 A G 2: 25,399,417 T304A probably benign Het
Etl4 A G 2: 20,798,649 T779A probably benign Het
Fam107b A T 2: 3,772,870 I35L probably benign Het
Fam196b G A 11: 34,402,231 G91E probably damaging Het
Fgg A T 3: 83,012,868 Y318F probably benign Het
Fitm1 A C 14: 55,576,619 T191P probably damaging Het
Fras1 A G 5: 96,776,724 M3675V probably damaging Het
Fry C T 5: 150,477,989 R731W probably damaging Het
Galnt17 A T 5: 131,306,399 S68T probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Grm1 C T 10: 10,936,513 A256T probably damaging Het
Hoxd13 A G 2: 74,668,683 Y125C probably benign Het
Hspa14 A T 2: 3,491,609 I373K probably benign Het
Ifnlr1 A G 4: 135,705,282 E343G probably benign Het
Ighv5-9 A G 12: 113,661,962 S54P probably benign Het
Irf2bpl A G 12: 86,882,118 S594P possibly damaging Het
Kcnq2 A G 2: 181,086,973 S548P probably damaging Het
Lrp2 G A 2: 69,472,368 R3006W probably damaging Het
Lrrc4c A T 2: 97,629,301 I91F probably damaging Het
Mdh1b T C 1: 63,711,504 D435G probably benign Het
Mettl3 A T 14: 52,299,727 S182T probably damaging Het
Mllt6 A G 11: 97,678,407 T862A probably benign Het
Mmp27 G T 9: 7,578,982 R412I probably damaging Het
Mstn A G 1: 53,066,423 N308S possibly damaging Het
Ncapg A G 5: 45,671,209 T101A probably benign Het
Ngf C T 3: 102,520,474 R180W probably damaging Het
Notch1 G A 2: 26,474,124 Q862* probably null Het
Nsrp1 T C 11: 77,045,744 D542G probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1444 T A 19: 12,862,552 M259K probably damaging Het
Olfr902 T A 9: 38,449,383 D170E probably benign Het
Papln C T 12: 83,782,903 P911S probably benign Het
Pdxdc1 A G 16: 13,876,069 V163A probably benign Het
Plekhj1 A T 10: 80,797,775 I76N probably damaging Het
Pnp2 A G 14: 50,963,568 probably null Het
Polr3gl T C 3: 96,579,892 E89G probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prss37 A G 6: 40,514,983 I221T possibly damaging Het
Ptx4 C T 17: 25,123,165 Q205* probably null Het
Qsox1 T C 1: 155,779,668 E583G probably benign Het
Riok3 T A 18: 12,155,243 N492K probably benign Het
Sec13 A G 6: 113,735,192 W61R probably damaging Het
Slc20a2 T C 8: 22,561,205 V418A possibly damaging Het
Smad9 G A 3: 54,789,230 V239I probably benign Het
Stmn2 A G 3: 8,545,732 E92G probably damaging Het
Taf1c A G 8: 119,598,798 V775A probably benign Het
Thsd7a T A 6: 12,330,992 I1384L probably benign Het
Tnxb A G 17: 34,713,632 Y2275C probably damaging Het
Trmo G T 4: 46,382,388 T243N probably benign Het
Vasp T C 7: 19,257,717 *376W probably null Het
Vmn1r231 T C 17: 20,890,351 I101V possibly damaging Het
Zfp532 T C 18: 65,623,766 S257P probably benign Het
Zfp563 G A 17: 33,105,709 C426Y probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp703 C A 8: 26,979,773 H488Q probably damaging Het
Zfp964 A G 8: 69,664,108 N452D possibly damaging Het
Zfyve28 A C 5: 34,233,354 Y188D probably damaging Het
Other mutations in Tyrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Tyrp1 APN 4 80840765 missense possibly damaging 0.95
IGL01586:Tyrp1 APN 4 80844898 missense probably benign 0.00
IGL01620:Tyrp1 APN 4 80844802 nonsense probably null
IGL02126:Tyrp1 APN 4 80837608 nonsense probably null
IGL02174:Tyrp1 APN 4 80844826 nonsense probably null
IGL02601:Tyrp1 APN 4 80840775 missense probably null 0.00
IGL02630:Tyrp1 APN 4 80840757 missense possibly damaging 0.95
butter UTSW 4 80840806 critical splice donor site probably null
ca-los UTSW 4 80844868 nonsense probably null
chi UTSW 4 80840778 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0145:Tyrp1 UTSW 4 80840778 missense probably damaging 1.00
R1172:Tyrp1 UTSW 4 80844868 nonsense probably null
R1173:Tyrp1 UTSW 4 80844868 nonsense probably null
R1175:Tyrp1 UTSW 4 80844868 nonsense probably null
R1886:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R2099:Tyrp1 UTSW 4 80835379 missense possibly damaging 0.69
R2273:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2274:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2275:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2312:Tyrp1 UTSW 4 80837564 nonsense probably null
R2427:Tyrp1 UTSW 4 80850871 missense probably benign 0.00
R2440:Tyrp1 UTSW 4 80846606 missense probably benign 0.41
R2915:Tyrp1 UTSW 4 80837455 missense possibly damaging 0.46
R4343:Tyrp1 UTSW 4 80849841 missense possibly damaging 0.92
R4512:Tyrp1 UTSW 4 80837512 missense probably damaging 1.00
R4703:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R4732:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4733:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4788:Tyrp1 UTSW 4 80844943 nonsense probably null
R4834:Tyrp1 UTSW 4 80846596 nonsense probably null
R4911:Tyrp1 UTSW 4 80850907 utr 3 prime probably benign
R5129:Tyrp1 UTSW 4 80846607 missense probably damaging 1.00
R5154:Tyrp1 UTSW 4 80850717 missense probably benign 0.00
R6249:Tyrp1 UTSW 4 80850772 missense possibly damaging 0.93
R6492:Tyrp1 UTSW 4 80840781 missense probably null 1.00
R6617:Tyrp1 UTSW 4 80846747 missense probably benign 0.24
R6870:Tyrp1 UTSW 4 80850777 missense probably benign 0.37
R6990:Tyrp1 UTSW 4 80835437 missense probably damaging 1.00
R7275:Tyrp1 UTSW 4 80837584 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CATTATTGACACACTCACTGACTCC -3'
(R):5'- AGAGGGACCTTACAGGCAAC -3'

Sequencing Primer
(F):5'- TCACTGACTCCTTAGCAGGTAGAG -3'
(R):5'- AATAGTAGCTGTCATTTGGGTCTTAC -3'
Posted On2016-04-27