Incidental Mutation 'R4938:Ifnlr1'
ID382833
Institutional Source Beutler Lab
Gene Symbol Ifnlr1
Ensembl Gene ENSMUSG00000062157
Gene Nameinterferon lambda receptor 1
SynonymsIFNLR1, Il28ra, CRF2-12
MMRRC Submission 042537-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4938 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135686287-135708181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135705282 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 343 (E343G)
Ref Sequence ENSEMBL: ENSMUSP00000074009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074408]
Predicted Effect probably benign
Transcript: ENSMUST00000074408
AA Change: E343G

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074009
Gene: ENSMUSG00000062157
AA Change: E343G

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
FN3 24 108 7.75e0 SMART
transmembrane domain 226 248 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 376 397 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and normal with respect to viral infection, however antiviral response evoked by TLRs are significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl14ep G T 2: 106,969,318 H59Q probably damaging Het
Atp6v0a4 T A 6: 38,078,814 I321F possibly damaging Het
Cdr2l A G 11: 115,393,825 D329G possibly damaging Het
Cep55 A G 19: 38,069,916 E319G probably damaging Het
Cfhr2 C T 1: 139,813,527 V237I probably benign Het
Clasrp A G 7: 19,584,778 probably null Het
Col12a1 C A 9: 79,700,350 E399* probably null Het
Cyp19a1 T A 9: 54,173,363 I237F probably benign Het
Dnajc6 T G 4: 101,636,813 N847K probably damaging Het
E330013P04Rik C G 19: 60,162,021 noncoding transcript Het
Entpd2 A G 2: 25,399,417 T304A probably benign Het
Etl4 A G 2: 20,798,649 T779A probably benign Het
Fam107b A T 2: 3,772,870 I35L probably benign Het
Fam196b G A 11: 34,402,231 G91E probably damaging Het
Fgg A T 3: 83,012,868 Y318F probably benign Het
Fitm1 A C 14: 55,576,619 T191P probably damaging Het
Fras1 A G 5: 96,776,724 M3675V probably damaging Het
Fry C T 5: 150,477,989 R731W probably damaging Het
Galnt17 A T 5: 131,306,399 S68T probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Grm1 C T 10: 10,936,513 A256T probably damaging Het
Hoxd13 A G 2: 74,668,683 Y125C probably benign Het
Hspa14 A T 2: 3,491,609 I373K probably benign Het
Ighv5-9 A G 12: 113,661,962 S54P probably benign Het
Irf2bpl A G 12: 86,882,118 S594P possibly damaging Het
Kcnq2 A G 2: 181,086,973 S548P probably damaging Het
Lrp2 G A 2: 69,472,368 R3006W probably damaging Het
Lrrc4c A T 2: 97,629,301 I91F probably damaging Het
Mdh1b T C 1: 63,711,504 D435G probably benign Het
Mettl3 A T 14: 52,299,727 S182T probably damaging Het
Mllt6 A G 11: 97,678,407 T862A probably benign Het
Mmp27 G T 9: 7,578,982 R412I probably damaging Het
Mstn A G 1: 53,066,423 N308S possibly damaging Het
Ncapg A G 5: 45,671,209 T101A probably benign Het
Ngf C T 3: 102,520,474 R180W probably damaging Het
Notch1 G A 2: 26,474,124 Q862* probably null Het
Nsrp1 T C 11: 77,045,744 D542G probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1444 T A 19: 12,862,552 M259K probably damaging Het
Olfr902 T A 9: 38,449,383 D170E probably benign Het
Papln C T 12: 83,782,903 P911S probably benign Het
Pdxdc1 A G 16: 13,876,069 V163A probably benign Het
Plekhj1 A T 10: 80,797,775 I76N probably damaging Het
Pnp2 A G 14: 50,963,568 probably null Het
Polr3gl T C 3: 96,579,892 E89G probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prss37 A G 6: 40,514,983 I221T possibly damaging Het
Ptx4 C T 17: 25,123,165 Q205* probably null Het
Qsox1 T C 1: 155,779,668 E583G probably benign Het
Riok3 T A 18: 12,155,243 N492K probably benign Het
Sec13 A G 6: 113,735,192 W61R probably damaging Het
Slc20a2 T C 8: 22,561,205 V418A possibly damaging Het
Smad9 G A 3: 54,789,230 V239I probably benign Het
Stmn2 A G 3: 8,545,732 E92G probably damaging Het
Taf1c A G 8: 119,598,798 V775A probably benign Het
Thsd7a T A 6: 12,330,992 I1384L probably benign Het
Tnxb A G 17: 34,713,632 Y2275C probably damaging Het
Trmo G T 4: 46,382,388 T243N probably benign Het
Tyrp1 C T 4: 80,840,646 A252V probably damaging Het
Vasp T C 7: 19,257,717 *376W probably null Het
Vmn1r231 T C 17: 20,890,351 I101V possibly damaging Het
Zfp532 T C 18: 65,623,766 S257P probably benign Het
Zfp563 G A 17: 33,105,709 C426Y probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp703 C A 8: 26,979,773 H488Q probably damaging Het
Zfp964 A G 8: 69,664,108 N452D possibly damaging Het
Zfyve28 A C 5: 34,233,354 Y188D probably damaging Het
Other mutations in Ifnlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Ifnlr1 APN 4 135704285 missense probably benign 0.28
IGL01637:Ifnlr1 APN 4 135686545 missense possibly damaging 0.63
IGL02090:Ifnlr1 APN 4 135705267 missense probably benign 0.23
R0677:Ifnlr1 UTSW 4 135705634 missense possibly damaging 0.78
R0723:Ifnlr1 UTSW 4 135701213 splice site probably benign
R0762:Ifnlr1 UTSW 4 135701329 missense possibly damaging 0.90
R1169:Ifnlr1 UTSW 4 135705108 missense probably benign 0.00
R1303:Ifnlr1 UTSW 4 135704217 missense possibly damaging 0.67
R1819:Ifnlr1 UTSW 4 135686523 start gained probably benign
R1957:Ifnlr1 UTSW 4 135686570 missense probably damaging 1.00
R2041:Ifnlr1 UTSW 4 135705837 missense possibly damaging 0.51
R2509:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R2510:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R2511:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R3020:Ifnlr1 UTSW 4 135705730 small deletion probably benign
R3944:Ifnlr1 UTSW 4 135701228 missense probably damaging 1.00
R4495:Ifnlr1 UTSW 4 135705768 missense probably damaging 0.98
R4804:Ifnlr1 UTSW 4 135705336 missense possibly damaging 0.50
R5070:Ifnlr1 UTSW 4 135704198 missense probably benign 0.00
R5073:Ifnlr1 UTSW 4 135705146 missense probably benign 0.06
R5493:Ifnlr1 UTSW 4 135705566 missense probably benign 0.25
R5913:Ifnlr1 UTSW 4 135705269 missense probably damaging 1.00
R5913:Ifnlr1 UTSW 4 135705270 missense probably damaging 1.00
R5959:Ifnlr1 UTSW 4 135705341 missense possibly damaging 0.94
R6032:Ifnlr1 UTSW 4 135705626 missense probably benign 0.03
R6032:Ifnlr1 UTSW 4 135705626 missense probably benign 0.03
R6136:Ifnlr1 UTSW 4 135703797 missense possibly damaging 0.92
R7018:Ifnlr1 UTSW 4 135703824 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATACCCAGTGGCAACCTTTCAG -3'
(R):5'- TGGAAGACCCAACTTCATCC -3'

Sequencing Primer
(F):5'- AACCTTTCAGCCCAGTGG -3'
(R):5'- GACCCAACTTCATCCTTATATGAGG -3'
Posted On2016-04-27