Incidental Mutation 'R4938:Mmp27'
ID382849
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Namematrix metallopeptidase 27
SynonymsLOC234911
MMRRC Submission 042537-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4938 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7571396-7581885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7578982 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Isoleucine at position 412 (R412I)
Ref Sequence ENSEMBL: ENSMUSP00000117469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120900
AA Change: R386I

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323
AA Change: R386I

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151853
AA Change: R412I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: R412I

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000152878
AA Change: R330I
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323
AA Change: R330I

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl14ep G T 2: 106,969,318 H59Q probably damaging Het
Atp6v0a4 T A 6: 38,078,814 I321F possibly damaging Het
Cdr2l A G 11: 115,393,825 D329G possibly damaging Het
Cep55 A G 19: 38,069,916 E319G probably damaging Het
Cfhr2 C T 1: 139,813,527 V237I probably benign Het
Clasrp A G 7: 19,584,778 probably null Het
Col12a1 C A 9: 79,700,350 E399* probably null Het
Cyp19a1 T A 9: 54,173,363 I237F probably benign Het
Dnajc6 T G 4: 101,636,813 N847K probably damaging Het
E330013P04Rik C G 19: 60,162,021 noncoding transcript Het
Entpd2 A G 2: 25,399,417 T304A probably benign Het
Etl4 A G 2: 20,798,649 T779A probably benign Het
Fam107b A T 2: 3,772,870 I35L probably benign Het
Fam196b G A 11: 34,402,231 G91E probably damaging Het
Fgg A T 3: 83,012,868 Y318F probably benign Het
Fitm1 A C 14: 55,576,619 T191P probably damaging Het
Fras1 A G 5: 96,776,724 M3675V probably damaging Het
Fry C T 5: 150,477,989 R731W probably damaging Het
Galnt17 A T 5: 131,306,399 S68T probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Grm1 C T 10: 10,936,513 A256T probably damaging Het
Hoxd13 A G 2: 74,668,683 Y125C probably benign Het
Hspa14 A T 2: 3,491,609 I373K probably benign Het
Ifnlr1 A G 4: 135,705,282 E343G probably benign Het
Ighv5-9 A G 12: 113,661,962 S54P probably benign Het
Irf2bpl A G 12: 86,882,118 S594P possibly damaging Het
Kcnq2 A G 2: 181,086,973 S548P probably damaging Het
Lrp2 G A 2: 69,472,368 R3006W probably damaging Het
Lrrc4c A T 2: 97,629,301 I91F probably damaging Het
Mdh1b T C 1: 63,711,504 D435G probably benign Het
Mettl3 A T 14: 52,299,727 S182T probably damaging Het
Mllt6 A G 11: 97,678,407 T862A probably benign Het
Mstn A G 1: 53,066,423 N308S possibly damaging Het
Ncapg A G 5: 45,671,209 T101A probably benign Het
Ngf C T 3: 102,520,474 R180W probably damaging Het
Notch1 G A 2: 26,474,124 Q862* probably null Het
Nsrp1 T C 11: 77,045,744 D542G probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1444 T A 19: 12,862,552 M259K probably damaging Het
Olfr902 T A 9: 38,449,383 D170E probably benign Het
Papln C T 12: 83,782,903 P911S probably benign Het
Pdxdc1 A G 16: 13,876,069 V163A probably benign Het
Plekhj1 A T 10: 80,797,775 I76N probably damaging Het
Pnp2 A G 14: 50,963,568 probably null Het
Polr3gl T C 3: 96,579,892 E89G probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prss37 A G 6: 40,514,983 I221T possibly damaging Het
Ptx4 C T 17: 25,123,165 Q205* probably null Het
Qsox1 T C 1: 155,779,668 E583G probably benign Het
Riok3 T A 18: 12,155,243 N492K probably benign Het
Sec13 A G 6: 113,735,192 W61R probably damaging Het
Slc20a2 T C 8: 22,561,205 V418A possibly damaging Het
Smad9 G A 3: 54,789,230 V239I probably benign Het
Stmn2 A G 3: 8,545,732 E92G probably damaging Het
Taf1c A G 8: 119,598,798 V775A probably benign Het
Thsd7a T A 6: 12,330,992 I1384L probably benign Het
Tnxb A G 17: 34,713,632 Y2275C probably damaging Het
Trmo G T 4: 46,382,388 T243N probably benign Het
Tyrp1 C T 4: 80,840,646 A252V probably damaging Het
Vasp T C 7: 19,257,717 *376W probably null Het
Vmn1r231 T C 17: 20,890,351 I101V possibly damaging Het
Zfp532 T C 18: 65,623,766 S257P probably benign Het
Zfp563 G A 17: 33,105,709 C426Y probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp703 C A 8: 26,979,773 H488Q probably damaging Het
Zfp964 A G 8: 69,664,108 N452D possibly damaging Het
Zfyve28 A C 5: 34,233,354 Y188D probably damaging Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7573504 splice site probably benign
IGL00656:Mmp27 APN 9 7581382 missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7578899 critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7573415 missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7573297 missense probably benign 0.06
IGL01631:Mmp27 APN 9 7573288 critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7571590 missense probably benign 0.03
IGL03024:Mmp27 APN 9 7581376 missense probably benign 0.17
R0662:Mmp27 UTSW 9 7577650 missense probably benign 0.00
R0715:Mmp27 UTSW 9 7581155 splice site probably benign
R0826:Mmp27 UTSW 9 7579009 missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7579066 splice site probably null
R1793:Mmp27 UTSW 9 7571458 start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7578897 splice site probably null
R2074:Mmp27 UTSW 9 7577739 missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7577378 nonsense probably null
R2445:Mmp27 UTSW 9 7581181 missense probably benign 0.12
R2961:Mmp27 UTSW 9 7573602 missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7581194 missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R5095:Mmp27 UTSW 9 7572158 missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7579000 missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R5446:Mmp27 UTSW 9 7573515 splice site probably benign
R5485:Mmp27 UTSW 9 7573362 missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7579062 missense probably null 1.00
R6682:Mmp27 UTSW 9 7573605 missense probably benign 0.02
R6712:Mmp27 UTSW 9 7572176 missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7571954 missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7578230 missense probably damaging 0.98
X0021:Mmp27 UTSW 9 7573298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAATAGAGGCATGAGATTACTGG -3'
(R):5'- GATTGCCGGCAACACAATCC -3'

Sequencing Primer
(F):5'- CATGAGATTACTGGGTTGGCAGC -3'
(R):5'- CCACTGGGAGACTGTAGATTTG -3'
Posted On2016-04-27