Incidental Mutation 'R4938:Zfp532'
ID382874
Institutional Source Beutler Lab
Gene Symbol Zfp532
Ensembl Gene ENSMUSG00000042439
Gene Namezinc finger protein 532
SynonymsC530030I18Rik
MMRRC Submission 042537-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R4938 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location65580230-65689443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65623766 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 257 (S257P)
Ref Sequence ENSEMBL: ENSMUSP00000138225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049016] [ENSMUST00000169679] [ENSMUST00000182140] [ENSMUST00000182319] [ENSMUST00000182478] [ENSMUST00000182655] [ENSMUST00000182684] [ENSMUST00000182852] [ENSMUST00000182973] [ENSMUST00000182979] [ENSMUST00000183236] [ENSMUST00000183319] [ENSMUST00000183326]
Predicted Effect probably benign
Transcript: ENSMUST00000049016
AA Change: S257P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036582
Gene: ENSMUSG00000042439
AA Change: S257P

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 784 807 1.25e-1 SMART
ZnF_C2H2 814 840 1.43e-1 SMART
low complexity region 860 872 N/A INTRINSIC
ZnF_C2H2 909 931 1.31e0 SMART
ZnF_C2H2 938 961 9.44e-2 SMART
ZnF_C2H2 999 1021 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169679
AA Change: S257P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129390
Gene: ENSMUSG00000042439
AA Change: S257P

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 784 807 1.25e-1 SMART
ZnF_C2H2 814 840 1.43e-1 SMART
low complexity region 860 872 N/A INTRINSIC
ZnF_C2H2 909 931 1.31e0 SMART
ZnF_C2H2 938 961 9.44e-2 SMART
ZnF_C2H2 999 1021 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182140
Predicted Effect probably benign
Transcript: ENSMUST00000182319
Predicted Effect probably benign
Transcript: ENSMUST00000182478
AA Change: S257P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138315
Gene: ENSMUSG00000042439
AA Change: S257P

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 780 802 4.34e0 SMART
ZnF_C2H2 808 832 1.55e1 SMART
ZnF_C2H2 839 862 8.94e-3 SMART
ZnF_C2H2 867 890 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182655
Predicted Effect probably benign
Transcript: ENSMUST00000182684
Predicted Effect probably benign
Transcript: ENSMUST00000182852
AA Change: S257P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138663
Gene: ENSMUSG00000042439
AA Change: S257P

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 780 802 4.34e0 SMART
ZnF_C2H2 808 832 1.55e1 SMART
ZnF_C2H2 839 862 8.94e-3 SMART
ZnF_C2H2 867 890 3.78e-1 SMART
ZnF_C2H2 902 924 7.15e-2 SMART
ZnF_C2H2 933 956 1.43e-1 SMART
ZnF_C2H2 1022 1045 4.72e-2 SMART
ZnF_C2H2 1052 1075 1.25e-1 SMART
ZnF_C2H2 1082 1108 1.43e-1 SMART
low complexity region 1128 1140 N/A INTRINSIC
ZnF_C2H2 1177 1199 1.31e0 SMART
ZnF_C2H2 1206 1229 9.44e-2 SMART
ZnF_C2H2 1267 1289 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182973
Predicted Effect probably benign
Transcript: ENSMUST00000182979
AA Change: S257P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138225
Gene: ENSMUSG00000042439
AA Change: S257P

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183184
Predicted Effect probably benign
Transcript: ENSMUST00000183236
Predicted Effect probably benign
Transcript: ENSMUST00000183319
Predicted Effect probably benign
Transcript: ENSMUST00000183326
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl14ep G T 2: 106,969,318 H59Q probably damaging Het
Atp6v0a4 T A 6: 38,078,814 I321F possibly damaging Het
Cdr2l A G 11: 115,393,825 D329G possibly damaging Het
Cep55 A G 19: 38,069,916 E319G probably damaging Het
Cfhr2 C T 1: 139,813,527 V237I probably benign Het
Clasrp A G 7: 19,584,778 probably null Het
Col12a1 C A 9: 79,700,350 E399* probably null Het
Cyp19a1 T A 9: 54,173,363 I237F probably benign Het
Dnajc6 T G 4: 101,636,813 N847K probably damaging Het
E330013P04Rik C G 19: 60,162,021 noncoding transcript Het
Entpd2 A G 2: 25,399,417 T304A probably benign Het
Etl4 A G 2: 20,798,649 T779A probably benign Het
Fam107b A T 2: 3,772,870 I35L probably benign Het
Fam196b G A 11: 34,402,231 G91E probably damaging Het
Fgg A T 3: 83,012,868 Y318F probably benign Het
Fitm1 A C 14: 55,576,619 T191P probably damaging Het
Fras1 A G 5: 96,776,724 M3675V probably damaging Het
Fry C T 5: 150,477,989 R731W probably damaging Het
Galnt17 A T 5: 131,306,399 S68T probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Grm1 C T 10: 10,936,513 A256T probably damaging Het
Hoxd13 A G 2: 74,668,683 Y125C probably benign Het
Hspa14 A T 2: 3,491,609 I373K probably benign Het
Ifnlr1 A G 4: 135,705,282 E343G probably benign Het
Ighv5-9 A G 12: 113,661,962 S54P probably benign Het
Irf2bpl A G 12: 86,882,118 S594P possibly damaging Het
Kcnq2 A G 2: 181,086,973 S548P probably damaging Het
Lrp2 G A 2: 69,472,368 R3006W probably damaging Het
Lrrc4c A T 2: 97,629,301 I91F probably damaging Het
Mdh1b T C 1: 63,711,504 D435G probably benign Het
Mettl3 A T 14: 52,299,727 S182T probably damaging Het
Mllt6 A G 11: 97,678,407 T862A probably benign Het
Mmp27 G T 9: 7,578,982 R412I probably damaging Het
Mstn A G 1: 53,066,423 N308S possibly damaging Het
Ncapg A G 5: 45,671,209 T101A probably benign Het
Ngf C T 3: 102,520,474 R180W probably damaging Het
Notch1 G A 2: 26,474,124 Q862* probably null Het
Nsrp1 T C 11: 77,045,744 D542G probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1444 T A 19: 12,862,552 M259K probably damaging Het
Olfr902 T A 9: 38,449,383 D170E probably benign Het
Papln C T 12: 83,782,903 P911S probably benign Het
Pdxdc1 A G 16: 13,876,069 V163A probably benign Het
Plekhj1 A T 10: 80,797,775 I76N probably damaging Het
Pnp2 A G 14: 50,963,568 probably null Het
Polr3gl T C 3: 96,579,892 E89G probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prss37 A G 6: 40,514,983 I221T possibly damaging Het
Ptx4 C T 17: 25,123,165 Q205* probably null Het
Qsox1 T C 1: 155,779,668 E583G probably benign Het
Riok3 T A 18: 12,155,243 N492K probably benign Het
Sec13 A G 6: 113,735,192 W61R probably damaging Het
Slc20a2 T C 8: 22,561,205 V418A possibly damaging Het
Smad9 G A 3: 54,789,230 V239I probably benign Het
Stmn2 A G 3: 8,545,732 E92G probably damaging Het
Taf1c A G 8: 119,598,798 V775A probably benign Het
Thsd7a T A 6: 12,330,992 I1384L probably benign Het
Tnxb A G 17: 34,713,632 Y2275C probably damaging Het
Trmo G T 4: 46,382,388 T243N probably benign Het
Tyrp1 C T 4: 80,840,646 A252V probably damaging Het
Vasp T C 7: 19,257,717 *376W probably null Het
Vmn1r231 T C 17: 20,890,351 I101V possibly damaging Het
Zfp563 G A 17: 33,105,709 C426Y probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp703 C A 8: 26,979,773 H488Q probably damaging Het
Zfp964 A G 8: 69,664,108 N452D possibly damaging Het
Zfyve28 A C 5: 34,233,354 Y188D probably damaging Het
Other mutations in Zfp532
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02341:Zfp532 APN 18 65624778 missense probably damaging 1.00
IGL02451:Zfp532 APN 18 65623601 missense probably damaging 0.96
IGL02496:Zfp532 APN 18 65624042 missense probably damaging 1.00
PIT4151001:Zfp532 UTSW 18 65624414 missense probably damaging 1.00
R0048:Zfp532 UTSW 18 65644333 missense probably damaging 1.00
R0076:Zfp532 UTSW 18 65685627 missense probably benign 0.07
R0095:Zfp532 UTSW 18 65624784 missense probably damaging 1.00
R0239:Zfp532 UTSW 18 65682985 missense possibly damaging 0.63
R0239:Zfp532 UTSW 18 65682985 missense possibly damaging 0.63
R0539:Zfp532 UTSW 18 65623766 missense probably benign 0.04
R0948:Zfp532 UTSW 18 65623818 missense probably damaging 1.00
R1447:Zfp532 UTSW 18 65624990 missense probably damaging 1.00
R1645:Zfp532 UTSW 18 65687264 missense probably benign 0.26
R1749:Zfp532 UTSW 18 65623484 missense possibly damaging 0.83
R1797:Zfp532 UTSW 18 65625144 missense probably benign 0.04
R1934:Zfp532 UTSW 18 65685611 missense probably damaging 0.97
R1959:Zfp532 UTSW 18 65624492 missense probably damaging 0.99
R2153:Zfp532 UTSW 18 65624927 missense possibly damaging 0.93
R2280:Zfp532 UTSW 18 65624712 missense probably damaging 0.96
R2281:Zfp532 UTSW 18 65624712 missense probably damaging 0.96
R2847:Zfp532 UTSW 18 65656626 missense possibly damaging 0.79
R2848:Zfp532 UTSW 18 65656626 missense possibly damaging 0.79
R4483:Zfp532 UTSW 18 65656565 missense probably benign 0.02
R4947:Zfp532 UTSW 18 65625066 missense possibly damaging 0.46
R5714:Zfp532 UTSW 18 65623535 missense possibly damaging 0.93
R5920:Zfp532 UTSW 18 65644350 missense probably benign
R6035:Zfp532 UTSW 18 65623934 missense possibly damaging 0.95
R6035:Zfp532 UTSW 18 65623934 missense possibly damaging 0.95
R6092:Zfp532 UTSW 18 65644210 missense probably damaging 1.00
R6170:Zfp532 UTSW 18 65624438 missense probably damaging 0.97
R6180:Zfp532 UTSW 18 65656471 missense probably benign
R6889:Zfp532 UTSW 18 65686990 missense possibly damaging 0.66
R7039:Zfp532 UTSW 18 65638763 missense probably benign 0.44
R7095:Zfp532 UTSW 18 65682898 missense probably benign
R7313:Zfp532 UTSW 18 65623005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCTCTACATCAGGCCACAC -3'
(R):5'- TCGATGAGATTCTGGGACTCG -3'

Sequencing Primer
(F):5'- GGCCACACGGATAAAAACAAGGTC -3'
(R):5'- ATTCTGGGACTCGGGAGAC -3'
Posted On2016-04-27