Incidental Mutation 'R4939:Plxna4'
ID382909
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
MMRRC Submission 042538-MU
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R4939 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32165762 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1586 (Y1586C)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect probably damaging
Transcript: ENSMUST00000115096
AA Change: Y1586C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: Y1586C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,243,725 Y365F possibly damaging Het
Atp2a1 T C 7: 126,450,116 M585V probably benign Het
Brca1 A G 11: 101,508,050 V1572A probably benign Het
C1ql4 A T 15: 99,087,640 M30K probably damaging Het
Ccdc73 A G 2: 104,992,157 probably null Het
Cdk6 A T 5: 3,344,377 D4V probably null Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Clic4 T C 4: 135,223,541 E113G probably benign Het
Creld1 C A 6: 113,488,179 H122Q probably benign Het
Cyp4a29 G A 4: 115,247,676 probably null Het
Dnaaf3 A T 7: 4,527,145 S246R probably damaging Het
Dnah12 A T 14: 26,891,524 T3925S probably damaging Het
Dnajc21 T A 15: 10,449,597 D446V probably damaging Het
Dock8 A T 19: 25,122,400 Y629F probably damaging Het
E2f8 A T 7: 48,872,138 N405K probably benign Het
Flg A G 3: 93,279,847 N202S probably benign Het
Glyatl3 A G 17: 40,910,023 probably null Het
Gm10696 A T 3: 94,176,233 Y90* probably null Het
Gm38999 A G 7: 43,428,461 T63A possibly damaging Het
Gm4981 T C 10: 58,235,603 N263S probably benign Het
Grap A G 11: 61,660,298 Y52C probably damaging Het
Haus2 T A 2: 120,619,036 I187K probably damaging Het
Heatr5b T C 17: 78,762,260 E1686G probably benign Het
Herc2 A G 7: 56,206,736 D3944G probably damaging Het
Hexdc A T 11: 121,207,716 M9L probably benign Het
Hoxa3 T C 6: 52,170,676 probably benign Het
Hspg2 A T 4: 137,508,031 I126F probably damaging Het
Itpr1 T A 6: 108,440,558 C123* probably null Het
Jmjd1c T A 10: 67,246,137 N2346K possibly damaging Het
Kctd9 A G 14: 67,729,686 Y37C probably damaging Het
Kmt5b A C 19: 3,815,245 S747R possibly damaging Het
Krt26 T C 11: 99,334,696 M320V probably benign Het
Lama1 T G 17: 67,737,475 V123G possibly damaging Het
Lamc2 T C 1: 153,126,836 D1103G probably damaging Het
Lepr A T 4: 101,733,438 K71I possibly damaging Het
Llgl1 A T 11: 60,709,979 probably null Het
Mcoln2 A T 3: 146,192,241 H39L probably benign Het
Myh11 T A 16: 14,239,507 T315S probably benign Het
Ncapd3 T C 9: 27,063,869 probably null Het
Nlrp9b G T 7: 20,024,496 V553F probably damaging Het
Nubpl A G 12: 52,181,095 N129S probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1390 A G 11: 49,340,549 T6A probably benign Het
Olfr1469 T A 19: 13,410,855 N95K probably benign Het
Olfr218 T C 1: 173,203,463 Y36H possibly damaging Het
Olfr325 G T 11: 58,581,211 M122I probably damaging Het
Olfr464 G T 11: 87,914,124 P261T probably damaging Het
Olfr619 T C 7: 103,604,251 V199A probably benign Het
Orc3 G A 4: 34,593,126 Q256* probably null Het
Pbrm1 A G 14: 31,061,623 M566V probably damaging Het
Pde6b A G 5: 108,421,497 I357V probably benign Het
Pkdrej A G 15: 85,820,283 I484T possibly damaging Het
Plvap A G 8: 71,511,439 V93A probably benign Het
Ppfia4 A T 1: 134,328,079 L196Q possibly damaging Het
Ptpn13 T G 5: 103,517,469 probably null Het
Ranbp17 T C 11: 33,219,223 N997S probably benign Het
Rpap2 G T 5: 107,603,625 probably null Het
Rrm1 T C 7: 102,466,924 V683A probably benign Het
Ruvbl1 A G 6: 88,483,039 probably null Het
Sh3pxd2a A G 19: 47,278,404 Y277H probably damaging Het
Shank1 C T 7: 44,326,162 P477S unknown Het
Shtn1 T C 19: 59,022,201 E278G probably benign Het
Skap2 T A 6: 51,922,323 I109F possibly damaging Het
Skiv2l2 T C 13: 112,909,892 D308G possibly damaging Het
Slc28a3 A C 13: 58,558,581 I615M probably benign Het
Slc4a11 A G 2: 130,684,868 L780P probably damaging Het
Slc5a4b T C 10: 76,081,467 E245G probably benign Het
Slfn8 C T 11: 83,003,285 A843T probably benign Het
Sncaip A T 18: 52,907,263 Q843L possibly damaging Het
Spidr T A 16: 16,140,746 K51* probably null Het
Tas2r123 T C 6: 132,847,845 V235A probably benign Het
Tgfbr3 T C 5: 107,130,469 D757G probably benign Het
Tmem132d A T 5: 127,796,075 V490D probably damaging Het
Top2a T A 11: 99,010,092 H557L probably damaging Het
Trafd1 A G 5: 121,375,191 I328T probably benign Het
Trappc11 G A 8: 47,519,665 A291V probably damaging Het
Tuba1c A G 15: 99,037,954 Y432C probably damaging Het
Utp11 T G 4: 124,683,250 R109S possibly damaging Het
Vmn1r159 T G 7: 22,842,891 T239P probably damaging Het
Vwce A T 19: 10,645,050 N239Y probably damaging Het
Yes1 T C 5: 32,645,113 probably null Het
Zfand6 A C 7: 84,615,822 *224G probably null Het
Zfp408 A T 2: 91,645,105 I668N probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp946 T C 17: 22,455,437 F391L probably damaging Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
inclined UTSW 6 32237723 nonsense probably null
slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R5153:Plxna4 UTSW 6 32224159 intron probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32496756 missense probably benign 0.01
R7199:Plxna4 UTSW 6 32215178 nonsense probably null
R7248:Plxna4 UTSW 6 32162160 missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32239520 missense possibly damaging 0.79
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTGAGTGACGTCGGCTC -3'
(R):5'- GTGATTCCTACATGAGACACACAG -3'

Sequencing Primer
(F):5'- AGTGACGTCGGCTCCCTTTG -3'
(R):5'- TTCCTACATGAGACACACAGGAACAG -3'
Posted On2016-04-27