Incidental Mutation 'R4940:Abca15'
ID383006
Institutional Source Beutler Lab
Gene Symbol Abca15
Ensembl Gene ENSMUSG00000054746
Gene NameATP-binding cassette, sub-family A (ABC1), member 15
Synonyms4930500I12Rik
Accession Numbers

NCBI RefSeq: NM_177213.3; MGI:2388709

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4940 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location120328670-120407687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120332694 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 57 (Y57H)
Ref Sequence ENSEMBL: ENSMUSP00000146489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076272] [ENSMUST00000121265] [ENSMUST00000207220]
Predicted Effect probably benign
Transcript: ENSMUST00000076272
AA Change: Y57H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075621
Gene: ENSMUSG00000054746
AA Change: Y57H

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 5.7e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 892 1293 7.9e-24 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121265
AA Change: Y57H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112821
Gene: ENSMUSG00000054746
AA Change: Y57H

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 2.1e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 907 1293 1e-25 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140459
Predicted Effect probably benign
Transcript: ENSMUST00000207220
AA Change: Y57H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,737,636 H134R possibly damaging Het
3632451O06Rik A T 14: 49,773,482 M256K probably benign Het
4931414P19Rik T C 14: 54,591,325 T240A probably benign Het
Adgrf4 A G 17: 42,666,529 I641T possibly damaging Het
Ankrd11 A G 8: 122,889,821 Y2410H probably damaging Het
Apbb2 C A 5: 66,452,261 L14F probably null Het
Arhgdia T C 11: 120,579,235 D204G probably damaging Het
Catsperd A T 17: 56,662,736 Y610F possibly damaging Het
Cblb T A 16: 52,033,103 D27E probably damaging Het
Ccdc180 A T 4: 45,917,453 I893F probably damaging Het
Ccdc180 A G 4: 45,917,508 H911R probably damaging Het
Cdh23 T A 10: 60,307,935 I2966F probably damaging Het
Chat G A 14: 32,419,105 P445L probably damaging Het
Chdh G T 14: 30,032,852 R273L possibly damaging Het
Clic3 T C 2: 25,457,917 V72A probably benign Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Ddr1 T A 17: 35,690,130 D241V probably damaging Het
Dock7 T A 4: 99,020,077 K605N probably damaging Het
Dsg2 T A 18: 20,579,430 F164I probably damaging Het
Dstyk T A 1: 132,453,106 N446K probably damaging Het
Epb42 A T 2: 121,034,451 L53Q probably damaging Het
Extl2 G C 3: 116,027,192 K229N probably benign Het
Frmd4b T A 6: 97,298,090 S617C probably damaging Het
Fscb C T 12: 64,473,814 V293I probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm4978 A C 9: 69,450,872 probably benign Het
Gm6729 A G 10: 86,540,388 noncoding transcript Het
Gnat2 A C 3: 108,100,616 N293T probably benign Het
Herpud1 T C 8: 94,390,842 I142T probably benign Het
Irak2 G A 6: 113,693,730 V536I probably benign Het
Kcnu1 A T 8: 25,897,862 probably null Het
Kdm4a A G 4: 118,161,754 S422P probably benign Het
Lair1 T A 7: 4,028,949 D53V probably benign Het
Lhx1 G T 11: 84,519,909 Y196* probably null Het
Lrrc37a G A 11: 103,497,612 T2329I unknown Het
Mag T C 7: 30,909,200 D163G probably damaging Het
Magi3 A G 3: 104,051,392 V459A probably damaging Het
Med13 A G 11: 86,288,118 Y1451H probably damaging Het
Megf8 T A 7: 25,360,706 C2341S probably damaging Het
Mppe1 A G 18: 67,228,024 C221R probably damaging Het
Mtus1 T A 8: 41,041,478 H39L possibly damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nutm2 T C 13: 50,474,873 C658R possibly damaging Het
Olfm1 T C 2: 28,222,590 V239A possibly damaging Het
Pcnx C T 12: 81,917,793 H245Y possibly damaging Het
Pgm3 A G 9: 86,559,476 L356S probably damaging Het
Pik3r4 C G 9: 105,668,994 H207D probably benign Het
Pkd1l1 T C 11: 8,844,585 T1859A probably benign Het
Pon3 A T 6: 5,221,625 V335E possibly damaging Het
Ppp4r3b A G 11: 29,211,740 T705A probably benign Het
Prmt7 T C 8: 106,237,278 V268A probably benign Het
Psd C T 19: 46,322,417 G398R probably damaging Het
Pygl A G 12: 70,206,381 V188A probably damaging Het
Rnf13 T A 3: 57,796,206 N110K probably damaging Het
Rnf170 C T 8: 26,125,911 Q77* probably null Het
Rrp8 A T 7: 105,734,077 Y327* probably null Het
Ruvbl2 T C 7: 45,424,726 D228G probably damaging Het
Scgn T A 13: 23,989,824 T35S probably benign Het
Scyl3 C T 1: 163,934,747 P74S probably damaging Het
Sec61b T G 4: 47,483,074 S123A probably benign Het
Sertad2 T C 11: 20,647,899 S32P possibly damaging Het
Slc23a3 T C 1: 75,133,803 probably null Het
Sult2a2 T G 7: 13,738,298 V140G probably benign Het
Tbc1d4 A T 14: 101,507,231 S320T probably benign Het
Trabd2b T C 4: 114,408,944 Y52H probably damaging Het
Traf2 T C 2: 25,530,288 E183G probably null Het
Trip10 G T 17: 57,263,017 V561F possibly damaging Het
Ttc7 G T 17: 87,306,958 V184F probably benign Het
Ubc A G 5: 125,386,229 V678A probably benign Het
Unk A G 11: 116,053,665 E414G possibly damaging Het
Usp42 T C 5: 143,719,762 N365D probably damaging Het
Zbtb26 A T 2: 37,436,769 I85K probably damaging Het
Zfhx2 A T 14: 55,066,434 H1364Q possibly damaging Het
Other mutations in Abca15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca15 APN 7 120397054 missense probably damaging 1.00
IGL00505:Abca15 APN 7 120369236 critical splice donor site probably null
IGL00851:Abca15 APN 7 120340007 missense probably damaging 1.00
IGL00985:Abca15 APN 7 120397018 missense probably damaging 1.00
IGL01114:Abca15 APN 7 120361420 missense probably damaging 0.99
IGL01287:Abca15 APN 7 120332858 utr 3 prime probably benign
IGL01333:Abca15 APN 7 120382308 missense probably damaging 1.00
IGL01482:Abca15 APN 7 120382746 missense probably benign 0.00
IGL01610:Abca15 APN 7 120340644 missense probably damaging 0.98
IGL02238:Abca15 APN 7 120396606 missense probably benign 0.02
IGL02377:Abca15 APN 7 120365910 splice site probably benign
IGL02666:Abca15 APN 7 120335208 missense probably damaging 1.00
IGL02836:Abca15 APN 7 120388216 missense probably benign
IGL03337:Abca15 APN 7 120396707 missense probably benign 0.24
IGL03354:Abca15 APN 7 120394488 nonsense probably null
H8562:Abca15 UTSW 7 120374854 splice site probably benign
IGL03098:Abca15 UTSW 7 120388276 splice site probably null
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0076:Abca15 UTSW 7 120373685 splice site probably benign
R0165:Abca15 UTSW 7 120350903 splice site probably benign
R0311:Abca15 UTSW 7 120402904 missense probably damaging 0.98
R0387:Abca15 UTSW 7 120332852 critical splice donor site probably null
R0610:Abca15 UTSW 7 120365786 missense possibly damaging 0.75
R0612:Abca15 UTSW 7 120337255 missense probably damaging 1.00
R0704:Abca15 UTSW 7 120354523 missense probably damaging 0.98
R0890:Abca15 UTSW 7 120373713 missense probably benign 0.01
R0961:Abca15 UTSW 7 120360985 nonsense probably null
R1144:Abca15 UTSW 7 120360860 splice site probably benign
R1412:Abca15 UTSW 7 120345323 missense possibly damaging 0.93
R1419:Abca15 UTSW 7 120374902 missense probably benign 0.10
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1493:Abca15 UTSW 7 120382290 missense probably benign 0.00
R1513:Abca15 UTSW 7 120340099 missense probably damaging 0.96
R1702:Abca15 UTSW 7 120382702 missense probably benign 0.10
R1857:Abca15 UTSW 7 120361369 missense probably damaging 1.00
R1893:Abca15 UTSW 7 120340553 missense possibly damaging 0.85
R1901:Abca15 UTSW 7 120346099 missense probably damaging 1.00
R1951:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1953:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1962:Abca15 UTSW 7 120341245 missense probably damaging 1.00
R2063:Abca15 UTSW 7 120360904 missense possibly damaging 0.61
R2141:Abca15 UTSW 7 120407474 missense probably damaging 1.00
R2145:Abca15 UTSW 7 120354478 missense probably benign 0.08
R2182:Abca15 UTSW 7 120340227 nonsense probably null
R2425:Abca15 UTSW 7 120359810 missense probably damaging 1.00
R2444:Abca15 UTSW 7 120365897 missense probably damaging 1.00
R3023:Abca15 UTSW 7 120382779 missense probably benign 0.40
R3079:Abca15 UTSW 7 120385169 missense probably damaging 1.00
R3106:Abca15 UTSW 7 120396633 missense possibly damaging 0.63
R3622:Abca15 UTSW 7 120350813 nonsense probably null
R4085:Abca15 UTSW 7 120382726 missense probably damaging 1.00
R4233:Abca15 UTSW 7 120402979 nonsense probably null
R4591:Abca15 UTSW 7 120382413 missense probably damaging 1.00
R4612:Abca15 UTSW 7 120335161 missense probably benign 0.03
R4721:Abca15 UTSW 7 120350775 missense probably benign 0.01
R4838:Abca15 UTSW 7 120345300 missense probably benign 0.00
R4963:Abca15 UTSW 7 120360919 missense probably damaging 1.00
R4993:Abca15 UTSW 7 120401718 missense probably damaging 0.99
R5022:Abca15 UTSW 7 120346096 missense probably damaging 0.98
R5030:Abca15 UTSW 7 120340001 missense probably damaging 1.00
R5072:Abca15 UTSW 7 120406975 missense probably damaging 1.00
R5090:Abca15 UTSW 7 120385199 missense probably damaging 1.00
R5309:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5310:Abca15 UTSW 7 120332616 missense possibly damaging 0.46
R5312:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5482:Abca15 UTSW 7 120369147 missense probably damaging 1.00
R5596:Abca15 UTSW 7 120401749 missense possibly damaging 0.94
R5853:Abca15 UTSW 7 120340583 missense probably benign 0.00
R5950:Abca15 UTSW 7 120382656 missense probably damaging 1.00
R5953:Abca15 UTSW 7 120361018 missense probably damaging 1.00
R6072:Abca15 UTSW 7 120388258 missense probably damaging 0.98
R6131:Abca15 UTSW 7 120340205 missense probably benign 0.03
R6132:Abca15 UTSW 7 120361420 missense probably benign 0.14
R6136:Abca15 UTSW 7 120340049 missense possibly damaging 0.81
R6207:Abca15 UTSW 7 120373794 missense probably benign 0.01
R6315:Abca15 UTSW 7 120346092 missense probably damaging 1.00
R6417:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6420:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6595:Abca15 UTSW 7 120394487 missense probably benign 0.00
R6653:Abca15 UTSW 7 120346006 missense probably benign 0.03
R6859:Abca15 UTSW 7 120402994 nonsense probably null
R6983:Abca15 UTSW 7 120354463 missense probably benign 0.26
R7127:Abca15 UTSW 7 120332602 missense probably benign 0.06
R7205:Abca15 UTSW 7 120394364 missense possibly damaging 0.89
R7336:Abca15 UTSW 7 120388233 missense possibly damaging 0.66
R7426:Abca15 UTSW 7 120345998 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GAGAAATAAGACAGCCTTTGACTTC -3'
(R):5'- CCCTTAGCTATGAGGATGTCC -3'

Sequencing Primer
(F):5'- AATAAGACAGCCTTTGACTTCTTCTC -3'
(R):5'- ATGTCCTACTGTGTCTTGTATAGAAG -3'
Posted On2016-04-27