Incidental Mutation 'R4941:4932438A13Rik'
ID383058
Institutional Source Beutler Lab
Gene Symbol 4932438A13Rik
Ensembl Gene ENSMUSG00000037270
Gene NameRIKEN cDNA 4932438A13 gene
SynonymsTweek, FSA
MMRRC Submission 042539-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R4941 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location36863104-37053033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 36917702 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 528 (H528P)
Ref Sequence ENSEMBL: ENSMUSP00000148720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000152564] [ENSMUST00000152881] [ENSMUST00000211820]
Predicted Effect probably damaging
Transcript: ENSMUST00000057272
AA Change: H528P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270
AA Change: H528P

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123916
Predicted Effect unknown
Transcript: ENSMUST00000128061
AA Change: H139P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143675
Predicted Effect probably damaging
Transcript: ENSMUST00000152564
AA Change: H528P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270
AA Change: H528P

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152881
SMART Domains Protein: ENSMUSP00000118366
Gene: ENSMUSG00000037270

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211820
AA Change: H528P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,228,328 I85F probably damaging Het
Abcc6 T A 7: 46,012,523 I435F probably benign Het
Adam3 T C 8: 24,677,316 probably benign Het
Adrb3 T C 8: 27,227,422 Y333C probably damaging Het
Ago4 A T 4: 126,526,054 D43E probably benign Het
Agt T A 8: 124,556,988 Q464L probably benign Het
Amdhd1 A T 10: 93,531,601 D230E probably damaging Het
Aplf A G 6: 87,668,423 I33T probably damaging Het
Aplf A T 6: 87,646,349 N249K probably benign Het
Arap2 A G 5: 62,749,478 M66T probably benign Het
Atf4 T C 15: 80,256,233 probably benign Het
AU019823 G T 9: 50,607,509 Q268K probably benign Het
Bahcc1 A C 11: 120,286,665 H2068P probably benign Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Catsper1 C A 19: 5,341,438 A616D possibly damaging Het
Ccdc94 A G 17: 55,964,149 D97G possibly damaging Het
Cdkn3 A G 14: 46,769,863 D159G possibly damaging Het
Cep162 T C 9: 87,225,969 probably benign Het
Clca1 T A 3: 145,015,653 I386L probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cmtm3 T C 8: 104,343,828 L73P probably damaging Het
Cnksr3 A C 10: 7,152,925 L149R probably benign Het
Cope T C 8: 70,302,934 probably null Het
Cpa6 T A 1: 10,409,337 M224L probably benign Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Ddx55 T A 5: 124,568,716 L592* probably null Het
Deup1 T C 9: 15,588,027 M333V probably benign Het
Eif4a1 T C 11: 69,667,814 probably benign Het
Eif4g3 A C 4: 138,170,565 D1026A probably damaging Het
Eif5b T C 1: 38,051,199 V1153A probably damaging Het
Ercc8 G T 13: 108,160,767 probably benign Het
Fam227a C A 15: 79,640,003 probably null Het
Fat1 A G 8: 45,036,275 I3505V probably benign Het
Fat3 T G 9: 16,375,152 E1025A probably damaging Het
Fat4 C T 3: 38,957,452 R2234W probably damaging Het
Fer1l4 G T 2: 156,045,089 F634L probably damaging Het
Fetub G A 16: 22,937,874 V162I probably benign Het
Fgd4 T C 16: 16,484,538 Q51R probably benign Het
Fgfr2 T C 7: 130,198,445 H140R probably benign Het
Flt3 T A 5: 147,356,375 probably null Het
Gabrb1 A G 5: 72,136,778 N465S probably damaging Het
Gapdhs T C 7: 30,733,266 I206V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Glp2r T C 11: 67,746,703 probably null Het
Gm4956 T A 1: 21,298,082 noncoding transcript Het
Gtf2a1l A T 17: 88,714,922 D447V probably damaging Het
Hsd3b5 A G 3: 98,619,063 W356R probably damaging Het
Idh2 A T 7: 80,096,099 V335D probably damaging Het
Isyna1 T C 8: 70,595,496 I184T probably damaging Het
Kcnh2 A G 5: 24,331,087 S320P probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kpna6 A G 4: 129,648,032 F524S probably damaging Het
Lap3 A T 5: 45,506,197 M338L probably benign Het
Lins1 T C 7: 66,709,450 probably benign Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc43 A G 5: 123,501,063 D385G probably benign Het
Maf T C 8: 115,706,793 D24G unknown Het
Nell1 T C 7: 50,062,638 S69P probably benign Het
Olfr1342 C T 4: 118,689,892 V187I possibly damaging Het
Olfr1436 A G 19: 12,298,896 S79P possibly damaging Het
Olfr531 T A 7: 140,400,879 M56L probably benign Het
Olfr609 T C 7: 103,492,251 D209G probably damaging Het
Olfr91 C T 17: 37,093,592 G94E probably damaging Het
Olfr969 T C 9: 39,795,864 M163T possibly damaging Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Parp14 T C 16: 35,846,033 N1210S probably benign Het
Pcdhb10 C A 18: 37,412,834 T321K probably benign Het
Pcdhb8 C T 18: 37,356,006 L246F probably benign Het
Pcdhga1 T A 18: 37,662,606 I221K probably benign Het
Pcdhga9 T A 18: 37,738,132 V338E probably damaging Het
Pdcd11 T C 19: 47,119,886 S1231P probably damaging Het
Pde6c A T 19: 38,151,565 L325F probably damaging Het
Pnpla7 T A 2: 24,997,264 probably null Het
Pparg T A 6: 115,490,110 V478E probably damaging Het
Ppib T C 9: 66,060,390 V42A probably benign Het
Ppox T C 1: 171,277,593 M341V probably damaging Het
Proc T C 18: 32,125,113 K260E possibly damaging Het
Ptpro C T 6: 137,392,765 P525L probably damaging Het
Rnf14 C A 18: 38,308,382 A275E probably damaging Het
Scnn1b C T 7: 121,912,008 P306L probably damaging Het
Sec14l5 A G 16: 5,176,500 E386G probably damaging Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc26a5 A G 5: 21,820,386 I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 Y438C probably damaging Het
Spire1 T C 18: 67,519,314 E231G possibly damaging Het
Stab1 T A 14: 31,151,571 I1014F probably benign Het
Steap2 T C 5: 5,677,651 Y228C probably damaging Het
Tmem131l T C 3: 83,899,239 T1487A probably benign Het
Tmem171 A G 13: 98,692,295 F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 V199A probably damaging Het
Tmem45a T C 16: 56,822,289 N173S possibly damaging Het
Uqcrc2 C T 7: 120,643,078 R148C probably benign Het
Vmn2r116 A G 17: 23,401,142 K617E probably damaging Het
Xrcc6 T C 15: 82,039,812 L229P probably damaging Het
Zfp184 A G 13: 21,949,721 D46G probably damaging Het
Zfp790 T A 7: 29,829,491 C534S possibly damaging Het
Zfp990 A T 4: 145,536,837 N135I probably damaging Het
Other mutations in 4932438A13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:4932438A13Rik APN 3 37011727 missense probably benign 0.00
IGL00434:4932438A13Rik APN 3 36987299 missense probably damaging 0.98
IGL00640:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00693:4932438A13Rik APN 3 37052547 utr 3 prime probably benign
IGL00721:4932438A13Rik APN 3 37030751 splice site probably null
IGL00756:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00896:4932438A13Rik APN 3 37039462 missense probably benign
IGL00902:4932438A13Rik APN 3 37041345 missense probably damaging 1.00
IGL00980:4932438A13Rik APN 3 37000041 missense probably damaging 1.00
IGL01019:4932438A13Rik APN 3 37006984 critical splice acceptor site probably null
IGL01025:4932438A13Rik APN 3 37046280 missense possibly damaging 0.89
IGL01306:4932438A13Rik APN 3 37005013 splice site probably benign
IGL01370:4932438A13Rik APN 3 36947755 missense probably benign 0.07
IGL01377:4932438A13Rik APN 3 36973452 critical splice donor site probably null
IGL01401:4932438A13Rik APN 3 36942292 missense probably benign
IGL01419:4932438A13Rik APN 3 37048121 missense probably damaging 1.00
IGL01432:4932438A13Rik APN 3 37003759 missense possibly damaging 0.87
IGL01433:4932438A13Rik APN 3 36887770 missense probably damaging 1.00
IGL01452:4932438A13Rik APN 3 36996308 unclassified probably benign
IGL01520:4932438A13Rik APN 3 36973260 nonsense probably null
IGL01524:4932438A13Rik APN 3 36942382 missense possibly damaging 0.90
IGL01628:4932438A13Rik APN 3 37008485 missense probably damaging 1.00
IGL01638:4932438A13Rik APN 3 36974311 missense probably damaging 1.00
IGL01650:4932438A13Rik APN 3 36992673 splice site probably benign
IGL01717:4932438A13Rik APN 3 37034736 missense probably benign
IGL01767:4932438A13Rik APN 3 37041363 missense probably benign 0.29
IGL01813:4932438A13Rik APN 3 36928520 missense possibly damaging 0.90
IGL01998:4932438A13Rik APN 3 36957016 missense possibly damaging 0.49
IGL02172:4932438A13Rik APN 3 37004873 missense probably damaging 0.99
IGL02197:4932438A13Rik APN 3 36906735 missense probably damaging 1.00
IGL02248:4932438A13Rik APN 3 36969290 critical splice donor site probably null
IGL02273:4932438A13Rik APN 3 36921437 splice site probably benign
IGL02403:4932438A13Rik APN 3 37030664 missense probably benign
IGL02492:4932438A13Rik APN 3 37048113 missense probably benign 0.04
IGL02517:4932438A13Rik APN 3 36958868 missense probably damaging 1.00
IGL02519:4932438A13Rik APN 3 36895315 missense probably damaging 1.00
IGL02586:4932438A13Rik APN 3 37044608 nonsense probably null
IGL02620:4932438A13Rik APN 3 37035945 missense possibly damaging 0.95
IGL02621:4932438A13Rik APN 3 37041484 splice site probably benign
IGL02670:4932438A13Rik APN 3 36967305 nonsense probably null
IGL02806:4932438A13Rik APN 3 36946494 missense possibly damaging 0.95
IGL02985:4932438A13Rik APN 3 36958757 missense probably damaging 0.99
IGL03004:4932438A13Rik APN 3 36965677 splice site probably benign
IGL03037:4932438A13Rik APN 3 36969207 missense probably benign 0.23
IGL03037:4932438A13Rik APN 3 36969208 missense probably damaging 1.00
IGL03062:4932438A13Rik APN 3 37038517 splice site probably benign
IGL03137:4932438A13Rik APN 3 37034602 missense probably damaging 0.98
IGL03150:4932438A13Rik APN 3 36948066 missense probably damaging 1.00
IGL03204:4932438A13Rik APN 3 37050934 splice site probably benign
IGL03207:4932438A13Rik APN 3 36949996 missense possibly damaging 0.73
IGL03256:4932438A13Rik APN 3 36906683 splice site probably benign
IGL03264:4932438A13Rik APN 3 37002635 missense probably damaging 1.00
IGL03265:4932438A13Rik APN 3 37047991 missense probably benign 0.00
IGL03303:4932438A13Rik APN 3 36870077 missense possibly damaging 0.90
FR4340:4932438A13Rik UTSW 3 37050752 critical splice acceptor site probably benign
FR4737:4932438A13Rik UTSW 3 37050754 critical splice acceptor site probably benign
R0035:4932438A13Rik UTSW 3 36987598 nonsense probably null
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0092:4932438A13Rik UTSW 3 37028159 missense probably benign 0.41
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0256:4932438A13Rik UTSW 3 36917773 missense probably benign 0.01
R0277:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0321:4932438A13Rik UTSW 3 36906788 splice site probably null
R0323:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0335:4932438A13Rik UTSW 3 36969152 missense probably damaging 1.00
R0375:4932438A13Rik UTSW 3 37046252 missense probably damaging 0.99
R0437:4932438A13Rik UTSW 3 36989804 missense possibly damaging 0.81
R0445:4932438A13Rik UTSW 3 37000065 missense probably damaging 0.99
R0496:4932438A13Rik UTSW 3 36987635 missense probably damaging 1.00
R0531:4932438A13Rik UTSW 3 37036825 missense probably damaging 1.00
R0543:4932438A13Rik UTSW 3 36996458 missense probably benign 0.22
R0545:4932438A13Rik UTSW 3 36987690 splice site probably benign
R0674:4932438A13Rik UTSW 3 37044626 missense possibly damaging 0.86
R0745:4932438A13Rik UTSW 3 36928463 missense probably damaging 1.00
R0755:4932438A13Rik UTSW 3 36946364 missense probably damaging 1.00
R0785:4932438A13Rik UTSW 3 36959334 splice site probably benign
R1056:4932438A13Rik UTSW 3 36983453 missense possibly damaging 0.69
R1056:4932438A13Rik UTSW 3 37044680 missense probably benign 0.44
R1080:4932438A13Rik UTSW 3 36988255 missense probably damaging 1.00
R1103:4932438A13Rik UTSW 3 36996523 missense probably benign
R1119:4932438A13Rik UTSW 3 36987045 missense probably damaging 1.00
R1170:4932438A13Rik UTSW 3 37044631 missense probably damaging 0.98
R1183:4932438A13Rik UTSW 3 36895303 missense possibly damaging 0.51
R1186:4932438A13Rik UTSW 3 36996312 unclassified probably benign
R1201:4932438A13Rik UTSW 3 36948375 missense probably benign
R1219:4932438A13Rik UTSW 3 36946470 nonsense probably null
R1270:4932438A13Rik UTSW 3 36952184 missense probably damaging 1.00
R1273:4932438A13Rik UTSW 3 36987210 missense probably damaging 1.00
R1338:4932438A13Rik UTSW 3 37052535 missense unknown
R1364:4932438A13Rik UTSW 3 36987030 missense probably damaging 1.00
R1437:4932438A13Rik UTSW 3 36942429 missense possibly damaging 0.65
R1447:4932438A13Rik UTSW 3 36965586 missense probably damaging 0.98
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1481:4932438A13Rik UTSW 3 37008434 missense probably damaging 0.99
R1528:4932438A13Rik UTSW 3 37052535 missense unknown
R1533:4932438A13Rik UTSW 3 37041375 missense probably damaging 1.00
R1546:4932438A13Rik UTSW 3 36870056 missense possibly damaging 0.64
R1606:4932438A13Rik UTSW 3 36942399 missense probably damaging 1.00
R1638:4932438A13Rik UTSW 3 37035812 nonsense probably null
R1772:4932438A13Rik UTSW 3 36959432 missense probably damaging 1.00
R1896:4932438A13Rik UTSW 3 36908231 nonsense probably null
R1919:4932438A13Rik UTSW 3 37006983 critical splice acceptor site probably null
R1983:4932438A13Rik UTSW 3 36887865 missense probably null 1.00
R1987:4932438A13Rik UTSW 3 36953985 critical splice donor site probably null
R1992:4932438A13Rik UTSW 3 37000032 missense probably benign 0.32
R1999:4932438A13Rik UTSW 3 36908211 missense probably damaging 1.00
R2004:4932438A13Rik UTSW 3 36895378 missense possibly damaging 0.77
R2010:4932438A13Rik UTSW 3 36928551 missense probably benign 0.09
R2027:4932438A13Rik UTSW 3 37047961 splice site probably benign
R2039:4932438A13Rik UTSW 3 37003878 missense possibly damaging 0.66
R2054:4932438A13Rik UTSW 3 36947853 missense probably benign 0.01
R2089:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36953970 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2220:4932438A13Rik UTSW 3 36875530 critical splice donor site probably null
R2374:4932438A13Rik UTSW 3 36885396 missense probably benign 0.00
R2437:4932438A13Rik UTSW 3 36958685 splice site probably null
R2860:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2861:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2909:4932438A13Rik UTSW 3 36947953 missense probably damaging 1.00
R2925:4932438A13Rik UTSW 3 37007122 missense probably damaging 0.99
R2940:4932438A13Rik UTSW 3 36958805 missense probably damaging 1.00
R3015:4932438A13Rik UTSW 3 36875462 missense probably damaging 1.00
R3086:4932438A13Rik UTSW 3 37011703 missense possibly damaging 0.56
R3159:4932438A13Rik UTSW 3 36959415 missense probably benign 0.17
R3440:4932438A13Rik UTSW 3 37041912 nonsense probably null
R3703:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3705:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3795:4932438A13Rik UTSW 3 37030565 missense probably benign 0.30
R3820:4932438A13Rik UTSW 3 37040434 missense probably damaging 1.00
R3862:4932438A13Rik UTSW 3 36885398 missense possibly damaging 0.73
R3944:4932438A13Rik UTSW 3 37030061 missense possibly damaging 0.90
R4020:4932438A13Rik UTSW 3 37012575 intron probably benign
R4091:4932438A13Rik UTSW 3 37030589 missense probably benign 0.00
R4159:4932438A13Rik UTSW 3 36931083 missense probably benign 0.00
R4231:4932438A13Rik UTSW 3 36920236 missense probably benign 0.10
R4368:4932438A13Rik UTSW 3 36988147 nonsense probably null
R4413:4932438A13Rik UTSW 3 36958681 splice site probably null
R4475:4932438A13Rik UTSW 3 37040395 missense probably damaging 1.00
R4488:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4489:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4516:4932438A13Rik UTSW 3 36895311 missense possibly damaging 0.90
R4580:4932438A13Rik UTSW 3 37030025 missense probably benign 0.02
R4672:4932438A13Rik UTSW 3 36889990 makesense probably null
R4705:4932438A13Rik UTSW 3 37041889 missense probably benign 0.03
R4735:4932438A13Rik UTSW 3 37004967 missense possibly damaging 0.84
R4741:4932438A13Rik UTSW 3 36942375 missense probably damaging 0.99
R4754:4932438A13Rik UTSW 3 37022466 nonsense probably null
R4778:4932438A13Rik UTSW 3 36937065 missense possibly damaging 0.90
R4833:4932438A13Rik UTSW 3 36964968 missense probably damaging 0.96
R4896:4932438A13Rik UTSW 3 36965937 missense probably damaging 1.00
R4910:4932438A13Rik UTSW 3 36998199 missense probably damaging 1.00
R4922:4932438A13Rik UTSW 3 36987165 missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36919901 missense probably benign 0.41
R4980:4932438A13Rik UTSW 3 36943312 missense probably damaging 1.00
R5030:4932438A13Rik UTSW 3 36943399 intron probably benign
R5049:4932438A13Rik UTSW 3 37040506 intron probably benign
R5049:4932438A13Rik UTSW 3 37041390 missense probably damaging 1.00
R5089:4932438A13Rik UTSW 3 36987502 missense probably benign 0.02
R5092:4932438A13Rik UTSW 3 37000085 missense probably benign 0.14
R5122:4932438A13Rik UTSW 3 37034757 splice site probably null
R5210:4932438A13Rik UTSW 3 37033265 missense possibly damaging 0.85
R5246:4932438A13Rik UTSW 3 37048050 missense probably damaging 1.00
R5289:4932438A13Rik UTSW 3 37000109 missense probably damaging 0.97
R5348:4932438A13Rik UTSW 3 37048146 missense probably damaging 1.00
R5394:4932438A13Rik UTSW 3 36917668 missense probably damaging 1.00
R5434:4932438A13Rik UTSW 3 36875516 missense probably damaging 1.00
R5667:4932438A13Rik UTSW 3 36917677 missense probably benign 0.00
R5686:4932438A13Rik UTSW 3 36917660 missense probably benign 0.00
R5701:4932438A13Rik UTSW 3 36921360 missense probably benign 0.10
R5778:4932438A13Rik UTSW 3 36958714 missense probably damaging 1.00
R5787:4932438A13Rik UTSW 3 36992733 unclassified probably null
R5800:4932438A13Rik UTSW 3 37052443 missense probably damaging 1.00
R5819:4932438A13Rik UTSW 3 37048600 missense probably benign 0.12
R5820:4932438A13Rik UTSW 3 37039526 missense probably benign 0.00
R5952:4932438A13Rik UTSW 3 36965621 missense probably damaging 1.00
R5975:4932438A13Rik UTSW 3 36969221 missense possibly damaging 0.64
R5996:4932438A13Rik UTSW 3 36931116 missense probably benign 0.07
R6192:4932438A13Rik UTSW 3 36988169 missense probably benign 0.00
R6225:4932438A13Rik UTSW 3 36948304 missense probably damaging 1.00
R6234:4932438A13Rik UTSW 3 36983471 missense probably benign 0.00
R6244:4932438A13Rik UTSW 3 36956999 missense probably benign
R6263:4932438A13Rik UTSW 3 36931111 missense probably benign 0.06
R6351:4932438A13Rik UTSW 3 36908228 missense probably damaging 1.00
R6380:4932438A13Rik UTSW 3 37033307 missense probably benign 0.19
R6468:4932438A13Rik UTSW 3 37008443 missense probably damaging 1.00
R6759:4932438A13Rik UTSW 3 36988085 missense possibly damaging 0.81
R6792:4932438A13Rik UTSW 3 37011566 critical splice acceptor site probably null
R6809:4932438A13Rik UTSW 3 36874282 missense probably damaging 0.98
R6841:4932438A13Rik UTSW 3 37021481 missense probably damaging 1.00
R6959:4932438A13Rik UTSW 3 36967189 missense probably damaging 1.00
X0050:4932438A13Rik UTSW 3 36957128 missense probably damaging 1.00
Z1088:4932438A13Rik UTSW 3 36987567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGCCCCTCATGTTTTC -3'
(R):5'- AAGGACACATCTGATTTCTGGGAC -3'

Sequencing Primer
(F):5'- CATGTTTTCTTCCCCATTAAAATAGG -3'
(R):5'- TGGGACAGAGGGAAGAAGG -3'
Posted On2016-04-27