Incidental Mutation 'R4941:Fgd4'
ID383136
Institutional Source Beutler Lab
Gene Symbol Fgd4
Ensembl Gene ENSMUSG00000022788
Gene NameFYVE, RhoGEF and PH domain containing 4
SynonymsFrabin-alpha, 9330209B17Rik, ZFYVE6, Frabin-gamma, Frabin-beta, Frabin
MMRRC Submission 042539-MU
Accession Numbers

Genbank: NM_139232; MGI: 2183747

Is this an essential gene? Possibly essential (E-score: 0.649) question?
Stock #R4941 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16416917-16600549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16484538 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 51 (Q51R)
Ref Sequence ENSEMBL: ENSMUSP00000125736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069284] [ENSMUST00000159542] [ENSMUST00000161188] [ENSMUST00000161861] [ENSMUST00000162671]
Predicted Effect probably benign
Transcript: ENSMUST00000069284
AA Change: Q51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069573
Gene: ENSMUSG00000022788
AA Change: Q51R

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159058
Predicted Effect probably benign
Transcript: ENSMUST00000159542
AA Change: Q51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125649
Gene: ENSMUSG00000022788
AA Change: Q51R

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161188
AA Change: Q51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123763
Gene: ENSMUSG00000022788
AA Change: Q51R

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 603 1.94e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161624
Predicted Effect probably benign
Transcript: ENSMUST00000161861
AA Change: Q51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125174
Gene: ENSMUSG00000022788
AA Change: Q51R

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162045
SMART Domains Protein: ENSMUSP00000125435
Gene: ENSMUSG00000022788

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 504 2.36e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162124
SMART Domains Protein: ENSMUSP00000125165
Gene: ENSMUSG00000022788

DomainStartEndE-ValueType
RhoGEF 166 348 1.48e-57 SMART
PH 379 460 2.36e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162542
Predicted Effect probably benign
Transcript: ENSMUST00000162671
AA Change: Q51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125736
Gene: ENSMUSG00000022788
AA Change: Q51R

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172181
SMART Domains Protein: ENSMUSP00000131870
Gene: ENSMUSG00000022788

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 603 1.94e-8 SMART
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: This gene is a member of the FYVE, RhoGEF and PH domain containing (FGD) family. The encoded protein is a Cdc42-specific guanine nucleotide exchange factor (GEF) that plays an essential role in regulating the actin cytoskeleton and cell morphology. Disruption of the gene in mouse causes abnormal nerve development and dysmyelination. Mutations in a similar gene in human can cause Charcot-Marie-Tooth disease type 4H (CMT4H), a disorder of the peripheral nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display dysmyelination in early peripheral nerve development, followed by severe myelin abnormalities, demyelinationn, nervous system electrophysiological deficits, and decreased grip strength at later stages. [provided by MGI curators]
Allele List at MGI

All alleles(60) : Gene trapped(60)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,917,702 H528P probably damaging Het
4932438A13Rik G A 3: 36,919,901 S600N probably benign Het
A4galt T A 15: 83,228,328 I85F probably damaging Het
Abcc6 T A 7: 46,012,523 I435F probably benign Het
Adam3 T C 8: 24,677,316 probably benign Het
Adrb3 T C 8: 27,227,422 Y333C probably damaging Het
Ago4 A T 4: 126,526,054 D43E probably benign Het
Agt T A 8: 124,556,988 Q464L probably benign Het
Amdhd1 A T 10: 93,531,601 D230E probably damaging Het
Aplf A G 6: 87,668,423 I33T probably damaging Het
Aplf A T 6: 87,646,349 N249K probably benign Het
Arap2 A G 5: 62,749,478 M66T probably benign Het
Atf4 T C 15: 80,256,233 probably benign Het
AU019823 G T 9: 50,607,509 Q268K probably benign Het
Bahcc1 A C 11: 120,286,665 H2068P probably benign Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Catsper1 C A 19: 5,341,438 A616D possibly damaging Het
Ccdc94 A G 17: 55,964,149 D97G possibly damaging Het
Cdkn3 A G 14: 46,769,863 D159G possibly damaging Het
Cep162 T C 9: 87,225,969 probably benign Het
Clca1 T A 3: 145,015,653 I386L probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cmtm3 T C 8: 104,343,828 L73P probably damaging Het
Cnksr3 A C 10: 7,152,925 L149R probably benign Het
Cope T C 8: 70,302,934 probably null Het
Cpa6 T A 1: 10,409,337 M224L probably benign Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Ddx55 T A 5: 124,568,716 L592* probably null Het
Deup1 T C 9: 15,588,027 M333V probably benign Het
Eif4a1 T C 11: 69,667,814 probably benign Het
Eif4g3 A C 4: 138,170,565 D1026A probably damaging Het
Eif5b T C 1: 38,051,199 V1153A probably damaging Het
Ercc8 G T 13: 108,160,767 probably benign Het
Fam227a C A 15: 79,640,003 probably null Het
Fat1 A G 8: 45,036,275 I3505V probably benign Het
Fat3 T G 9: 16,375,152 E1025A probably damaging Het
Fat4 C T 3: 38,957,452 R2234W probably damaging Het
Fer1l4 G T 2: 156,045,089 F634L probably damaging Het
Fetub G A 16: 22,937,874 V162I probably benign Het
Fgfr2 T C 7: 130,198,445 H140R probably benign Het
Flt3 T A 5: 147,356,375 probably null Het
Gabrb1 A G 5: 72,136,778 N465S probably damaging Het
Gapdhs T C 7: 30,733,266 I206V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Glp2r T C 11: 67,746,703 probably null Het
Gm4956 T A 1: 21,298,082 noncoding transcript Het
Gtf2a1l A T 17: 88,714,922 D447V probably damaging Het
Hsd3b5 A G 3: 98,619,063 W356R probably damaging Het
Idh2 A T 7: 80,096,099 V335D probably damaging Het
Isyna1 T C 8: 70,595,496 I184T probably damaging Het
Kcnh2 A G 5: 24,331,087 S320P probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kpna6 A G 4: 129,648,032 F524S probably damaging Het
Lap3 A T 5: 45,506,197 M338L probably benign Het
Lins1 T C 7: 66,709,450 probably benign Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc43 A G 5: 123,501,063 D385G probably benign Het
Maf T C 8: 115,706,793 D24G unknown Het
Nell1 T C 7: 50,062,638 S69P probably benign Het
Olfr1342 C T 4: 118,689,892 V187I possibly damaging Het
Olfr1436 A G 19: 12,298,896 S79P possibly damaging Het
Olfr531 T A 7: 140,400,879 M56L probably benign Het
Olfr609 T C 7: 103,492,251 D209G probably damaging Het
Olfr91 C T 17: 37,093,592 G94E probably damaging Het
Olfr969 T C 9: 39,795,864 M163T possibly damaging Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Parp14 T C 16: 35,846,033 N1210S probably benign Het
Pcdhb10 C A 18: 37,412,834 T321K probably benign Het
Pcdhb8 C T 18: 37,356,006 L246F probably benign Het
Pcdhga1 T A 18: 37,662,606 I221K probably benign Het
Pcdhga9 T A 18: 37,738,132 V338E probably damaging Het
Pdcd11 T C 19: 47,119,886 S1231P probably damaging Het
Pde6c A T 19: 38,151,565 L325F probably damaging Het
Pnpla7 T A 2: 24,997,264 probably null Het
Pparg T A 6: 115,490,110 V478E probably damaging Het
Ppib T C 9: 66,060,390 V42A probably benign Het
Ppox T C 1: 171,277,593 M341V probably damaging Het
Proc T C 18: 32,125,113 K260E possibly damaging Het
Ptpro C T 6: 137,392,765 P525L probably damaging Het
Rnf14 C A 18: 38,308,382 A275E probably damaging Het
Scnn1b C T 7: 121,912,008 P306L probably damaging Het
Sec14l5 A G 16: 5,176,500 E386G probably damaging Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc26a5 A G 5: 21,820,386 I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 Y438C probably damaging Het
Spire1 T C 18: 67,519,314 E231G possibly damaging Het
Stab1 T A 14: 31,151,571 I1014F probably benign Het
Steap2 T C 5: 5,677,651 Y228C probably damaging Het
Tmem131l T C 3: 83,899,239 T1487A probably benign Het
Tmem171 A G 13: 98,692,295 F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 V199A probably damaging Het
Tmem45a T C 16: 56,822,289 N173S possibly damaging Het
Uqcrc2 C T 7: 120,643,078 R148C probably benign Het
Vmn2r116 A G 17: 23,401,142 K617E probably damaging Het
Xrcc6 T C 15: 82,039,812 L229P probably damaging Het
Zfp184 A G 13: 21,949,721 D46G probably damaging Het
Zfp790 T A 7: 29,829,491 C534S possibly damaging Het
Zfp990 A T 4: 145,536,837 N135I probably damaging Het
Other mutations in Fgd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Fgd4 APN 16 16484303 missense probably damaging 0.99
IGL01455:Fgd4 APN 16 16490490 missense probably benign 0.22
IGL02035:Fgd4 APN 16 16490416 splice site probably benign
IGL02353:Fgd4 APN 16 16462045 missense probably damaging 0.96
IGL02360:Fgd4 APN 16 16462045 missense probably damaging 0.96
IGL03100:Fgd4 APN 16 16477519 splice site probably benign
11287:Fgd4 UTSW 16 16423923 missense probably damaging 1.00
R0787:Fgd4 UTSW 16 16423901 splice site probably benign
R0853:Fgd4 UTSW 16 16474387 splice site probably benign
R0879:Fgd4 UTSW 16 16477449 missense probably damaging 1.00
R1482:Fgd4 UTSW 16 16484473 missense probably benign 0.39
R1619:Fgd4 UTSW 16 16424056 missense possibly damaging 0.52
R1635:Fgd4 UTSW 16 16475029 nonsense probably null
R2018:Fgd4 UTSW 16 16435960 missense probably benign 0.15
R2120:Fgd4 UTSW 16 16425828 missense probably benign 0.44
R2292:Fgd4 UTSW 16 16436000 missense possibly damaging 0.95
R2902:Fgd4 UTSW 16 16425865 missense probably damaging 1.00
R4575:Fgd4 UTSW 16 16437032 missense probably damaging 1.00
R4747:Fgd4 UTSW 16 16423929 missense probably damaging 1.00
R5196:Fgd4 UTSW 16 16484142 missense probably benign 0.01
R5372:Fgd4 UTSW 16 16484291 missense probably benign 0.03
R5457:Fgd4 UTSW 16 16462009 missense probably benign 0.39
R5486:Fgd4 UTSW 16 16475037 missense probably damaging 1.00
R6709:Fgd4 UTSW 16 16484481 missense probably benign 0.09
Z1088:Fgd4 UTSW 16 16484470 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACATGTGTATCAGGAGAGGC -3'
(R):5'- TGTGTGCCAAGAATCTGCTTC -3'

Sequencing Primer
(F):5'- CTGAATAGCCATCTCTGGGCTAAG -3'
(R):5'- GTGTGCCAAGAATCTGCTTCTAAAAC -3'
Posted On2016-04-27