Mutagenetix > Incidental Mutation

Incidental Mutation 'R4942:Rpsa'

383208

Institutional Source

Beutler Lab

Gene Symbol

Rpsa

Ensembl Gene

ENSMUSG00000032518

Gene Name

ribosomal protein SA

Synonyms

P40-3, Lamrl1, Lamr1, Lamr, P40-8, 67lr

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4942 (G1)

Quality Score

176

Status

Not validated

Chromosome

Chromosomal Location

119956832-119961435 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119960129 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 231 (W231R)

Ref Sequence

ENSEMBL: ENSMUSP00000148933 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035105] [ENSMUST00000217317] [ENSMUST00000217352] [ENSMUST00000217356]

AlphaFold

P14206

Predicted Effect

probably benign
Transcript: ENSMUST00000035105
AA Change: W231R

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000035105
Gene: ENSMUSG00000032518
AA Change: W231R

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S2	18	118	3.7e-12	PFAM
Pfam:Ribosomal_S2	111	184	6.5e-14	PFAM
Pfam:40S_SA_C	202	295	2.9e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082991

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214963

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215568

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216043

Predicted Effect

probably benign
Transcript: ENSMUST00000217317
AA Change: W231R

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

probably benign
Transcript: ENSMUST00000217352

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216813

Predicted Effect

probably benign
Transcript: ENSMUST00000217356

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show right ventricular cardiomyocyte degeneration and higher susceptibility to arrhythmia. Homozygous null mice fail to develop past E3.5; heterozygotes show craniofacial defects, low mean corpuscular hemoglobin concentration and reduced insulin content in pancreatic islet cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730522E02Rik	A	G	11: 25,720,472 (GRCm39)		probably null	Het
Adamts7	T	C	9: 90,045,364 (GRCm39)	S23P	probably benign	Het
Adamtsl1	T	A	4: 86,259,451 (GRCm39)	C824*	probably null	Het
Adgre1	A	G	17: 57,713,903 (GRCm39)	Y196C	probably damaging	Het
Arap1	A	G	7: 101,051,009 (GRCm39)	D542G	possibly damaging	Het
B3gat1	A	G	9: 26,666,894 (GRCm39)	D42G	probably benign	Het
Birc6	G	A	17: 74,930,045 (GRCm39)	A2412T	probably damaging	Het
Bnip5	T	C	17: 29,122,232 (GRCm39)	R420G	probably benign	Het
Bsn	A	G	9: 107,983,678 (GRCm39)	Y3459H	unknown	Het
Cacnb1	T	C	11: 97,893,809 (GRCm39)	Y571C	probably damaging	Het
Cdk2ap2	G	A	19: 4,147,508 (GRCm39)		probably null	Het
Cep57	A	G	9: 13,724,723 (GRCm39)	S265P	probably damaging	Het
Clca3a1	A	G	3: 144,710,524 (GRCm39)	I893T	probably benign	Het
Clca3a2	T	A	3: 144,512,263 (GRCm39)	E491V	probably damaging	Het
Cldn10	G	A	14: 119,025,725 (GRCm39)	G53S	possibly damaging	Het
Cobl	A	T	11: 12,204,185 (GRCm39)	I832N	probably damaging	Het
Col9a2	T	C	4: 120,910,316 (GRCm39)	V487A	possibly damaging	Het
Cse1l	C	T	2: 166,771,714 (GRCm39)	T325I	probably damaging	Het
Dlx6	A	G	6: 6,863,468 (GRCm39)	Q30R	probably benign	Het
Dnah8	T	C	17: 30,948,116 (GRCm39)	V1902A	probably benign	Het
Dusp8	A	G	7: 141,635,965 (GRCm39)	F542L	possibly damaging	Het
Emid1	T	G	11: 5,079,430 (GRCm39)	M323L	probably benign	Het
Ercc5	A	G	1: 44,215,125 (GRCm39)	D886G	probably benign	Het
Fam184b	T	C	5: 45,730,649 (GRCm39)	E461G	probably damaging	Het
Fbn1	C	A	2: 125,225,536 (GRCm39)	C572F	possibly damaging	Het
Gigyf1	G	T	5: 137,523,952 (GRCm39)	V1041L	possibly damaging	Het
Grin3b	A	G	10: 79,811,556 (GRCm39)	H714R	probably damaging	Het
Heatr1	A	G	13: 12,428,391 (GRCm39)		probably null	Het
Klk14	G	A	7: 43,341,501 (GRCm39)	C51Y	probably damaging	Het
Llgl1	C	T	11: 60,600,394 (GRCm39)	P581L	probably benign	Het
Lypd6b	C	A	2: 49,836,132 (GRCm39)	H104Q	probably benign	Het
Man1a	A	T	10: 53,809,586 (GRCm39)		probably null	Het
Megf6	A	T	4: 154,338,277 (GRCm39)	D449V	probably damaging	Het
Mtor	T	C	4: 148,556,599 (GRCm39)	V1003A	probably benign	Het
Ncan	C	A	8: 70,552,944 (GRCm39)	W1096L	probably damaging	Het
Ndor1	C	T	2: 25,138,133 (GRCm39)		probably null	Het
Ndufaf1	T	C	2: 119,490,547 (GRCm39)	E171G	possibly damaging	Het
Nell1	T	C	7: 49,770,397 (GRCm39)	V152A	possibly damaging	Het
Nherf4	C	A	9: 44,159,915 (GRCm39)	G402*	probably null	Het
Nt5dc1	A	T	10: 34,198,673 (GRCm39)	V255E	probably damaging	Het
Or2a20	T	A	6: 43,193,928 (GRCm39)	F27Y	probably damaging	Het
Or2y1b	A	T	11: 49,208,375 (GRCm39)	M1L	probably null	Het
Or52h7	A	G	7: 104,214,212 (GRCm39)	I261M	probably benign	Het
Or52z14	G	A	7: 103,253,401 (GRCm39)	R180H	probably benign	Het
Otud7a	T	C	7: 63,407,171 (GRCm39)	I50T	probably damaging	Het
P2ry13	G	A	3: 59,116,983 (GRCm39)	T265I	probably benign	Het
Pde4d	A	G	13: 108,996,733 (GRCm39)	S12G	probably benign	Het
Pigk	C	A	3: 152,450,154 (GRCm39)	N219K	probably damaging	Het
Plcg1	T	A	2: 160,595,509 (GRCm39)		probably null	Het
Psd2	A	T	18: 36,111,717 (GRCm39)	D114V	probably damaging	Het
Ptch1	A	T	13: 63,672,884 (GRCm39)	I770N	probably benign	Het
Ptprq	A	T	10: 107,524,290 (GRCm39)	M481K	probably benign	Het
Rnf216	A	C	5: 143,078,814 (GRCm39)	M45R	probably damaging	Het
Ryr1	G	T	7: 28,768,998 (GRCm39)	T2797N	probably damaging	Het
Ryr3	A	T	2: 112,666,602 (GRCm39)	M1468K	probably damaging	Het
Slc6a7	A	G	18: 61,137,589 (GRCm39)	Y244H	probably damaging	Het
Slco6c1	T	A	1: 97,009,049 (GRCm39)	D462V	probably damaging	Het
Spata31d1b	A	T	13: 59,864,917 (GRCm39)	E688D	possibly damaging	Het
Srpra	G	A	9: 35,126,766 (GRCm39)	R508H	probably benign	Het
Tnrc18	A	T	5: 142,773,737 (GRCm39)	I181N	unknown	Het
Tnrc6a	T	C	7: 122,791,836 (GRCm39)	F1785L	probably damaging	Het
Trio	A	T	15: 27,752,811 (GRCm39)	D2174E	probably benign	Het
Ttn	C	T	2: 76,623,600 (GRCm39)	V15326I	probably damaging	Het
Ubap2	T	A	4: 41,245,461 (GRCm39)		probably benign	Het
Vmn2r113	C	T	17: 23,177,321 (GRCm39)	P702S	probably damaging	Het
Vmn2r66	A	T	7: 84,656,980 (GRCm39)	W142R	probably damaging	Het
Vmn2r73	A	G	7: 85,519,582 (GRCm39)	Y459H	probably damaging	Het
Wsb2	C	T	5: 117,515,550 (GRCm39)	T385M	probably damaging	Het

Other mutations in Rpsa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02503:Rpsa	APN	9	119,957,659 (GRCm39)	missense	possibly damaging	0.57
IGL02522:Rpsa	APN	9	119,960,121 (GRCm39)	missense	possibly damaging	0.47
PIT4515001:Rpsa	UTSW	9	119,960,214 (GRCm39)	missense	probably benign	0.04
R0281:Rpsa	UTSW	9	119,960,069 (GRCm39)	missense	possibly damaging	0.81
R1511:Rpsa	UTSW	9	119,960,066 (GRCm39)	missense	possibly damaging	0.64
R5814:Rpsa	UTSW	9	119,957,551 (GRCm39)	start gained	probably benign
R6122:Rpsa	UTSW	9	119,960,102 (GRCm39)	missense	probably benign	0.01
R6545:Rpsa	UTSW	9	119,959,323 (GRCm39)	missense	probably benign	0.11
R7225:Rpsa	UTSW	9	119,960,222 (GRCm39)	missense	probably benign	0.00
R8554:Rpsa	UTSW	9	119,958,317 (GRCm39)	missense	possibly damaging	0.80
RF012:Rpsa	UTSW	9	119,960,105 (GRCm39)	missense	probably benign	0.01
Z1176:Rpsa	UTSW	9	119,959,412 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTACTATCTCCCGTGAGCAC -3'
(R):5'- TGAAGCTTCGCCAATCTCTCAC -3'

Sequencing Primer
(F):5'- TCTTTACTTCTACAGAGACCCAGAGG -3'
(R):5'- TTCGCCAATCTCTCACAACCC -3'

Posted On

2016-04-27