Incidental Mutation 'R4944:Ndst3'
ID383328
Institutional Source Beutler Lab
Gene Symbol Ndst3
Ensembl Gene ENSMUSG00000027977
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms4930511P15Rik, 4921531K01Rik
MMRRC Submission 042541-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R4944 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location123526166-123690853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123607027 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 410 (H410R)
Ref Sequence ENSEMBL: ENSMUSP00000133657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000124803] [ENSMUST00000132112] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]
Predicted Effect probably damaging
Transcript: ENSMUST00000029602
AA Change: H410R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: H410R

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 4.6e-272 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124803
SMART Domains Protein: ENSMUSP00000122617
Gene: ENSMUSG00000027977

DomainStartEndE-ValueType
Pfam:HSNSD 1 91 1.7e-62 PFAM
Pfam:Sulfotransfer_1 180 443 7.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132112
SMART Domains Protein: ENSMUSP00000120623
Gene: ENSMUSG00000027977

DomainStartEndE-ValueType
Pfam:HSNSD 1 91 1.7e-62 PFAM
Pfam:Sulfotransfer_1 180 443 7.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137404
AA Change: H410R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977
AA Change: H410R

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 6.4e-272 PFAM
PDB:1NST|A 549 637 2e-38 PDB
SCOP:d1nsta_ 570 641 9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154668
AA Change: H410R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: H410R

DomainStartEndE-ValueType
Pfam:HSNSD 20 506 1.7e-253 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172537
AA Change: H410R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: H410R

DomainStartEndE-ValueType
Pfam:HSNSD 20 328 2.4e-130 PFAM
Pfam:HSNSD 326 425 8.2e-62 PFAM
PDB:1NST|A 468 556 7e-39 PDB
SCOP:d1nsta_ 489 560 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199046
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G A 5: 8,934,327 probably null Het
Angptl7 C G 4: 148,500,077 Q71H probably damaging Het
Arhgap30 A T 1: 171,402,254 N176Y probably damaging Het
Armc9 T A 1: 86,274,534 S805T probably damaging Het
Atxn1 T G 13: 45,566,931 H496P probably damaging Het
Cabin1 C T 10: 75,721,363 G1147D probably damaging Het
Cabin1 A G 10: 75,739,421 S597P probably damaging Het
Catsperd T C 17: 56,662,744 S613P probably damaging Het
Cdh2 A G 18: 16,650,409 Y88H probably damaging Het
Cntn1 C A 15: 92,228,668 P47Q probably damaging Het
Col11a2 T C 17: 34,042,190 L38P possibly damaging Het
Col5a2 T G 1: 45,376,695 I1431L possibly damaging Het
Csmd1 C T 8: 15,998,772 G2310D probably damaging Het
Dhcr7 T A 7: 143,837,791 I39N probably damaging Het
Diexf A T 1: 193,114,954 M530K probably damaging Het
Dnajc13 C T 9: 104,167,387 probably benign Het
Folr2 T C 7: 101,840,290 probably null Het
Galnt11 T C 5: 25,265,338 I595T probably damaging Het
Gm884 T C 11: 103,613,460 T2561A possibly damaging Het
Gp5 G A 16: 30,309,508 A116V possibly damaging Het
Gpn3 T C 5: 122,382,240 probably benign Het
Gprin3 T C 6: 59,354,659 N221S probably benign Het
Hfm1 T C 5: 106,874,213 E989G possibly damaging Het
Ints1 T C 5: 139,758,092 probably null Het
Josd2 T C 7: 44,471,168 S110P probably damaging Het
Kat14 C A 2: 144,375,953 T123K probably damaging Het
Lamtor1 C T 7: 101,909,764 T48I probably damaging Het
Lrrc24 A G 15: 76,718,346 L113P probably damaging Het
Mog T C 17: 37,020,541 E89G probably damaging Het
Mon2 A G 10: 123,038,459 probably null Het
Mtx1 T C 3: 89,213,898 Y143C probably benign Het
Nacad T C 11: 6,598,507 E1409G possibly damaging Het
Nkx6-2 T C 7: 139,581,570 E233G possibly damaging Het
Oas1h A G 5: 120,862,783 E152G probably damaging Het
Olfr936 A G 9: 39,046,862 S186P probably damaging Het
Ovgp1 T C 3: 105,979,953 F222L possibly damaging Het
Pkhd1 T C 1: 20,288,205 S2716G probably null Het
Pla2g4e T C 2: 120,171,237 T644A probably benign Het
Plxnd1 A G 6: 115,955,765 I1918T probably damaging Het
Prrxl1 G T 14: 32,608,249 Q136H probably damaging Het
Psmg1 A T 16: 95,989,612 probably benign Het
Ptprd G A 4: 76,128,899 R364C probably damaging Het
Rgs22 T C 15: 36,025,942 I945V possibly damaging Het
Rgs7bp T C 13: 104,951,564 N234S probably benign Het
Rrp7a T C 15: 83,119,809 probably benign Het
Scg2 T A 1: 79,436,476 R177* probably null Het
Sema4c C A 1: 36,550,311 C578F probably damaging Het
Slc1a5 T A 7: 16,797,743 probably benign Het
Slc5a3 A G 16: 92,078,683 T543A possibly damaging Het
Slx4ip T A 2: 137,046,767 F123I probably benign Het
Smtn C T 11: 3,522,916 R737H probably damaging Het
Stox2 A G 8: 47,413,265 I14T possibly damaging Het
Stradb T C 1: 58,980,440 F43L probably benign Het
Szt2 T C 4: 118,388,669 D1029G probably benign Het
Taar6 T C 10: 23,984,715 Y311C probably damaging Het
Tcea3 A T 4: 136,268,093 N249I probably damaging Het
Tecta A G 9: 42,330,277 M2134T probably benign Het
Tg G A 15: 66,764,337 G591D probably damaging Het
Tm4sf20 T A 1: 82,768,363 I19F probably benign Het
Top2a T C 11: 98,997,850 K1262E probably benign Het
Ube2r2 A G 4: 41,190,742 probably benign Het
Usp29 T C 7: 6,961,928 S257P possibly damaging Het
Usp40 T C 1: 87,952,355 N1038S probably benign Het
Vmn1r121 C T 7: 21,097,613 E301K probably benign Het
Vmn2r49 T A 7: 9,989,032 H105L probably benign Het
Zgrf1 C T 3: 127,561,868 Q248* probably null Het
Other mutations in Ndst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Ndst3 APN 3 123627950 splice site probably benign
IGL00543:Ndst3 APN 3 123672263 missense probably damaging 0.99
IGL01067:Ndst3 APN 3 123546817 missense probably damaging 1.00
IGL01301:Ndst3 APN 3 123548916 missense probably damaging 0.97
IGL01975:Ndst3 APN 3 123601514 missense possibly damaging 0.67
IGL02376:Ndst3 APN 3 123556798 missense probably damaging 0.98
IGL02715:Ndst3 APN 3 123546761 splice site probably benign
IGL03111:Ndst3 APN 3 123672096 missense possibly damaging 0.96
Jack_sprat UTSW 3 123552552 missense probably damaging 0.99
ANU18:Ndst3 UTSW 3 123548916 missense probably damaging 0.97
R0027:Ndst3 UTSW 3 123671513 missense probably damaging 1.00
R0288:Ndst3 UTSW 3 123672194 missense probably benign 0.03
R0630:Ndst3 UTSW 3 123562071 missense probably damaging 0.98
R1168:Ndst3 UTSW 3 123606968 missense probably benign 0.22
R1400:Ndst3 UTSW 3 123556828 missense probably damaging 1.00
R1513:Ndst3 UTSW 3 123601455 missense possibly damaging 0.75
R1524:Ndst3 UTSW 3 123548906 missense possibly damaging 0.94
R1830:Ndst3 UTSW 3 123548938 missense probably damaging 0.96
R1831:Ndst3 UTSW 3 123601478 missense probably benign
R1865:Ndst3 UTSW 3 123671471 missense probably damaging 1.00
R1871:Ndst3 UTSW 3 123562024 missense probably damaging 1.00
R2041:Ndst3 UTSW 3 123672215 missense probably benign 0.01
R2056:Ndst3 UTSW 3 123671885 missense probably damaging 0.98
R2362:Ndst3 UTSW 3 123552678 missense possibly damaging 0.94
R2484:Ndst3 UTSW 3 123552537 missense possibly damaging 0.83
R3747:Ndst3 UTSW 3 123671552 missense probably benign 0.09
R4152:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4153:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4154:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4512:Ndst3 UTSW 3 123671666 missense probably damaging 1.00
R4579:Ndst3 UTSW 3 123546825 missense probably benign 0.00
R4611:Ndst3 UTSW 3 123671549 missense probably benign 0.35
R4646:Ndst3 UTSW 3 123672035 missense probably damaging 0.96
R4718:Ndst3 UTSW 3 123672266 missense probably benign 0.35
R4945:Ndst3 UTSW 3 123552552 missense probably damaging 1.00
R5179:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
R5232:Ndst3 UTSW 3 123672239 missense probably damaging 0.99
R5421:Ndst3 UTSW 3 123634359 intron probably null
R5874:Ndst3 UTSW 3 123561907 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6228:Ndst3 UTSW 3 123671652 nonsense probably null
R6496:Ndst3 UTSW 3 123552552 missense probably damaging 0.99
R6562:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGTGAATGAAGCCTCTCCG -3'
(R):5'- ACCCAATGTCAAGTATTCTCATGG -3'

Sequencing Primer
(F):5'- GTGAATGAAGCCTCTCCGATATC -3'
(R):5'- CAAATCTTCAAAGTTAGGCATGGTGG -3'
Posted On2016-04-27