Incidental Mutation 'R4946:Ank2'
ID383397
Institutional Source Beutler Lab
Gene Symbol Ank2
Ensembl Gene ENSMUSG00000032826
Gene Nameankyrin 2, brain
SynonymsAnkyrin-B, Ank-2, Ankyrin-2, Gm4392, ankyrin B
MMRRC Submission 042543-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4946 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location126921612-127499350 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 126941940 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000044443] [ENSMUST00000182064] [ENSMUST00000182078]
Predicted Effect probably benign
Transcript: ENSMUST00000044443
SMART Domains Protein: ENSMUSP00000043765
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
ZU5 128 232 4.13e-61 SMART
Pfam:ZU5 289 374 2.8e-8 PFAM
low complexity region 587 597 N/A INTRINSIC
DEATH 603 697 1.52e-27 SMART
low complexity region 732 748 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182025
Predicted Effect probably benign
Transcript: ENSMUST00000182062
Predicted Effect unknown
Transcript: ENSMUST00000182064
AA Change: S3432T
SMART Domains Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826
AA Change: S3432T

DomainStartEndE-ValueType
ANK 9 38 1e1 SMART
ANK 42 71 8.9e-7 SMART
ANK 75 104 4.4e-9 SMART
ANK 108 137 2.8e-9 SMART
ANK 141 169 5.3e-1 SMART
ANK 170 199 7.3e-1 SMART
ANK 211 240 1.1e-7 SMART
ANK 244 273 4.4e-9 SMART
ANK 277 306 9.3e-8 SMART
ANK 310 339 2.1e-8 SMART
ANK 343 372 1.3e-7 SMART
ANK 376 405 6.2e-9 SMART
ANK 409 438 1.1e-7 SMART
ANK 442 471 2.9e-8 SMART
ANK 475 504 1.1e-5 SMART
ANK 508 537 6.5e-6 SMART
ANK 541 570 2.3e-7 SMART
ANK 574 603 2.4e-7 SMART
ANK 607 636 3.2e-9 SMART
ANK 640 669 5.5e-5 SMART
ANK 673 702 1.9e-8 SMART
ANK 706 735 3.3e-9 SMART
low complexity region 755 775 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
ZU5 912 1016 2e-63 SMART
low complexity region 1371 1381 N/A INTRINSIC
low complexity region 1448 1463 N/A INTRINSIC
low complexity region 1490 1503 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182078
AA Change: S3345T
SMART Domains Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826
AA Change: S3345T

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
DEATH 591 685 1e-29 SMART
low complexity region 720 736 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000182594
AA Change: S3428T
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,086,474 D98G probably damaging Het
Adgre1 G A 17: 57,443,918 V531I probably benign Het
Aldoart2 A G 12: 55,566,016 Q242R probably benign Het
Ank3 C T 10: 69,898,117 A737V probably damaging Het
Ankle2 A G 5: 110,253,838 I789V probably benign Het
Ankrd13c T C 3: 158,005,773 V510A probably damaging Het
Arid1b T A 17: 5,342,843 M2216K probably damaging Het
Arrdc1 A G 2: 24,925,848 V380A probably benign Het
B3galt1 C A 2: 68,118,569 N209K possibly damaging Het
Cd300c2 A T 11: 114,996,905 C224S probably benign Het
Cdk4 T C 10: 127,064,890 probably null Het
Cdk5rap1 T C 2: 154,368,874 T115A possibly damaging Het
Clvs1 A T 4: 9,281,831 R92* probably null Het
Cnga1 A G 5: 72,604,764 V469A probably damaging Het
Ctns A G 11: 73,196,653 F16L probably benign Het
Dlg5 A T 14: 24,154,361 C1299S probably damaging Het
Dnah3 T A 7: 119,931,560 Y3690F probably damaging Het
Dnah5 A G 15: 28,326,557 M1971V probably damaging Het
Dnah5 G A 15: 28,387,904 V3170M probably damaging Het
Dpp8 T C 9: 65,055,918 Y485H probably benign Het
Dsc2 T C 18: 20,050,157 D68G probably damaging Het
Elavl1 A T 8: 4,301,752 D121E probably benign Het
Ermap A G 4: 119,183,308 V311A probably damaging Het
Fam102b A G 3: 108,980,228 V240A probably benign Het
Fbxw11 C T 11: 32,739,226 R437C probably damaging Het
Gas2l3 T C 10: 89,413,772 M495V probably benign Het
Hacd1 C T 2: 14,045,137 probably null Het
Itgav A G 2: 83,788,983 R596G probably benign Het
Kars T C 8: 112,001,720 H215R possibly damaging Het
Kif26a G A 12: 112,177,794 R1494H probably damaging Het
Klf12 G A 14: 100,022,957 S112L possibly damaging Het
Krt77 T C 15: 101,869,563 Y19C unknown Het
Lrrc4c A G 2: 97,630,489 T487A probably benign Het
Lrrn1 A G 6: 107,568,890 M550V probably benign Het
Lsr C A 7: 30,958,209 R442L probably benign Het
Lysmd2 A C 9: 75,635,446 T112P probably damaging Het
Mctp2 A T 7: 72,259,269 S99T probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mill2 T A 7: 18,856,683 probably null Het
Mpp3 T C 11: 102,005,022 N476D probably benign Het
Mtmr6 C T 14: 60,280,189 P83L possibly damaging Het
Myh3 T C 11: 67,093,538 I1067T probably benign Het
Myh9 C A 15: 77,773,340 Q1068H probably damaging Het
Narf T A 11: 121,250,353 H304Q possibly damaging Het
Nfatc2ip G T 7: 126,396,612 P35Q possibly damaging Het
Npas3 C A 12: 54,065,835 P426Q probably damaging Het
Olfr1289 T C 2: 111,483,966 Y207H possibly damaging Het
Olfr1508 G A 14: 52,463,283 T242I probably damaging Het
Olfr432 T G 1: 174,050,834 S154A possibly damaging Het
Olfr467 A G 7: 107,815,382 H266R possibly damaging Het
Olfr640 T A 7: 104,022,012 Q102L probably damaging Het
Pcdh10 A T 3: 45,379,482 E77V probably damaging Het
Pcnt C T 10: 76,356,185 R2764Q probably damaging Het
Pgbd5 T C 8: 124,370,585 D493G possibly damaging Het
Piezo2 G T 18: 63,157,262 T142N probably benign Het
Plcb1 A G 2: 135,345,095 I761V probably benign Het
Plekhg4 T G 8: 105,381,996 D1196E probably null Het
Pparg A G 6: 115,451,028 K159E probably damaging Het
Psmb1 A T 17: 15,498,216 M16K probably benign Het
Ptprq T C 10: 107,525,734 I2139V probably benign Het
Ralgapb T A 2: 158,440,967 S239T probably damaging Het
Serpina11 A G 12: 103,984,664 V266A probably damaging Het
Sf3a2 C G 10: 80,804,113 probably benign Het
Smim18 T C 8: 33,742,559 T11A possibly damaging Het
Snx6 G A 12: 54,770,743 T7I probably damaging Het
Srcin1 T A 11: 97,551,942 D75V probably damaging Het
Srsf12 T A 4: 33,231,174 S223T probably damaging Het
Taf4b G T 18: 14,813,542 C474F probably damaging Het
Tango6 T A 8: 106,718,090 C542* probably null Het
Tbc1d24 A G 17: 24,208,536 S151P possibly damaging Het
Tssk6 T C 8: 69,903,064 S253P probably benign Het
Ttc39c G A 18: 12,724,942 W300* probably null Het
Ttc6 T A 12: 57,643,140 W539R probably benign Het
Ttn T C 2: 76,752,426 T22708A probably damaging Het
Ttn C A 2: 76,918,709 E3999* probably null Het
Vill T G 9: 119,068,440 L261R probably damaging Het
Vmn1r20 T C 6: 57,432,174 S162P probably damaging Het
Zfp516 T C 18: 82,956,094 I139T probably benign Het
Other mutations in Ank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Ank2 APN 3 126959720 missense possibly damaging 0.80
IGL01652:Ank2 APN 3 126933041 missense probably benign 0.00
IGL01969:Ank2 APN 3 126953223 missense possibly damaging 0.47
IGL02122:Ank2 APN 3 126937874 splice site probably benign
IGL02537:Ank2 APN 3 126955916 missense probably damaging 1.00
IGL02858:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL02981:Ank2 APN 3 126934562 missense possibly damaging 0.58
IGL02981:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03024:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03074:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03111:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03129:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03174:Ank2 APN 3 126940095 missense probably damaging 0.98
IGL03177:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03185:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03188:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03242:Ank2 APN 3 126928805 missense possibly damaging 0.90
IGL03244:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03248:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03285:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03304:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03358:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03380:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03389:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03400:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03409:Ank2 APN 3 126955870 missense probably damaging 1.00
R0033:Ank2 UTSW 3 127104748 splice site probably benign
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0079:Ank2 UTSW 3 126934615 missense probably benign 0.01
R0423:Ank2 UTSW 3 126929860 nonsense probably null
R0699:Ank2 UTSW 3 126929829 missense probably benign 0.00
R0724:Ank2 UTSW 3 126962337 missense probably damaging 1.00
R0990:Ank2 UTSW 3 126934666 missense possibly damaging 0.64
R1450:Ank2 UTSW 3 126957302 missense possibly damaging 0.94
R1500:Ank2 UTSW 3 126932982 missense probably benign
R1702:Ank2 UTSW 3 126955899 missense probably benign 0.00
R1703:Ank2 UTSW 3 126929766 missense probably damaging 1.00
R1710:Ank2 UTSW 3 126933060 nonsense probably null
R1743:Ank2 UTSW 3 126928675 missense probably damaging 0.99
R1775:Ank2 UTSW 3 126934547 missense probably benign 0.00
R1852:Ank2 UTSW 3 126997851 critical splice donor site probably null
R2198:Ank2 UTSW 3 126934577 missense possibly damaging 0.73
R2892:Ank2 UTSW 3 127248243 splice site probably null
R2893:Ank2 UTSW 3 127248243 splice site probably null
R2894:Ank2 UTSW 3 127248243 splice site probably null
R3148:Ank2 UTSW 3 126933075 missense probably benign 0.00
R3776:Ank2 UTSW 3 126942262 intron probably benign
R3784:Ank2 UTSW 3 126953193 missense probably damaging 1.00
R3856:Ank2 UTSW 3 126929844 missense probably benign 0.00
R3906:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3907:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3953:Ank2 UTSW 3 126988160 missense probably damaging 1.00
R3963:Ank2 UTSW 3 126934596 missense probably benign
R4367:Ank2 UTSW 3 126946149 missense probably benign
R4414:Ank2 UTSW 3 127225762 critical splice donor site probably null
R4432:Ank2 UTSW 3 126947806 intron probably benign
R4433:Ank2 UTSW 3 126947806 intron probably benign
R4579:Ank2 UTSW 3 126958963 missense probably damaging 1.00
R4597:Ank2 UTSW 3 126988151 missense probably damaging 1.00
R4603:Ank2 UTSW 3 127032016 missense probably benign 0.00
R4729:Ank2 UTSW 3 126976896 nonsense probably null
R4815:Ank2 UTSW 3 126936761 missense probably benign
R4826:Ank2 UTSW 3 126956001 missense probably benign 0.35
R4871:Ank2 UTSW 3 126959795 missense probably damaging 1.00
R4880:Ank2 UTSW 3 127046826 splice site probably null
R4915:Ank2 UTSW 3 126942671 intron probably benign
R4935:Ank2 UTSW 3 126956064 missense probably damaging 1.00
R4936:Ank2 UTSW 3 126955039 missense possibly damaging 0.94
R4937:Ank2 UTSW 3 126962401 missense probably damaging 1.00
R4963:Ank2 UTSW 3 127032096 missense probably benign 0.01
R4989:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5023:Ank2 UTSW 3 126941871 intron probably benign
R5060:Ank2 UTSW 3 126945921 intron probably benign
R5078:Ank2 UTSW 3 126942353 intron probably benign
R5086:Ank2 UTSW 3 126947348 intron probably benign
R5134:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5148:Ank2 UTSW 3 127025636 intron probably null
R5175:Ank2 UTSW 3 127004024 missense probably damaging 1.00
R5275:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5295:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5303:Ank2 UTSW 3 126945804 intron probably benign
R5309:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5312:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5352:Ank2 UTSW 3 127498991 utr 5 prime probably benign
R5355:Ank2 UTSW 3 126944049 intron probably benign
R5386:Ank2 UTSW 3 126981933 missense probably benign 0.01
R5396:Ank2 UTSW 3 126953226 missense probably damaging 1.00
R5518:Ank2 UTSW 3 126959699 missense probably damaging 0.98
R5534:Ank2 UTSW 3 126947298 intron probably benign
R5554:Ank2 UTSW 3 126998973 missense possibly damaging 0.78
R5582:Ank2 UTSW 3 126946305 intron probably benign
R5747:Ank2 UTSW 3 126941751 intron probably benign
R5794:Ank2 UTSW 3 126930020 missense probably benign 0.00
R5831:Ank2 UTSW 3 127339159 start gained probably benign
R5925:Ank2 UTSW 3 126932963 missense probably benign 0.18
R5954:Ank2 UTSW 3 126997861 missense probably benign 0.34
R5956:Ank2 UTSW 3 126942688 intron probably benign
R5986:Ank2 UTSW 3 127012686 missense possibly damaging 0.94
R5992:Ank2 UTSW 3 126959651 critical splice donor site probably null
R6020:Ank2 UTSW 3 126946821 intron probably benign
R6027:Ank2 UTSW 3 126997879 missense possibly damaging 0.92
R6049:Ank2 UTSW 3 126943020 missense possibly damaging 0.95
R6060:Ank2 UTSW 3 126955952 missense probably damaging 1.00
R6114:Ank2 UTSW 3 127011051 missense probably damaging 1.00
R6124:Ank2 UTSW 3 127248151 missense probably benign 0.31
R6156:Ank2 UTSW 3 126944237 missense probably damaging 1.00
R6173:Ank2 UTSW 3 127052746 missense probably damaging 1.00
R6176:Ank2 UTSW 3 126945471 missense probably benign 0.05
R6184:Ank2 UTSW 3 126962398 missense probably damaging 1.00
R6199:Ank2 UTSW 3 127004006 missense probably damaging 1.00
R6241:Ank2 UTSW 3 127052748 missense probably damaging 1.00
R6254:Ank2 UTSW 3 126941804 intron probably benign
R6259:Ank2 UTSW 3 127016986 missense probably benign 0.28
R6260:Ank2 UTSW 3 126943557 missense probably benign
R6321:Ank2 UTSW 3 126946938 intron probably benign
R6393:Ank2 UTSW 3 126929757 missense probably damaging 1.00
R6406:Ank2 UTSW 3 127032225 missense probably damaging 1.00
R6544:Ank2 UTSW 3 126933222 missense probably damaging 0.99
R6583:Ank2 UTSW 3 127016964 missense probably damaging 1.00
R6739:Ank2 UTSW 3 127079994 missense probably damaging 1.00
R6754:Ank2 UTSW 3 127096839 intron probably benign
R6786:Ank2 UTSW 3 126958932 missense probably damaging 0.99
R6798:Ank2 UTSW 3 126944264 intron probably benign
R6882:Ank2 UTSW 3 126945757 intron probably benign
R6940:Ank2 UTSW 3 126941972 intron probably benign
R6949:Ank2 UTSW 3 127010884 missense probably benign 0.00
R7001:Ank2 UTSW 3 127077581 missense probably damaging 1.00
R7033:Ank2 UTSW 3 126944850 nonsense probably null
R7036:Ank2 UTSW 3 126946392 intron probably benign
R7045:Ank2 UTSW 3 127012744 missense probably damaging 1.00
R7048:Ank2 UTSW 3 127025618 missense probably benign 0.03
R7054:Ank2 UTSW 3 126943303 intron probably benign
R7069:Ank2 UTSW 3 126946298 intron probably benign
R7091:Ank2 UTSW 3 127023351 missense probably damaging 0.98
R7107:Ank2 UTSW 3 127003982 missense probably damaging 1.00
Z1088:Ank2 UTSW 3 127029509 missense possibly damaging 0.45
Predicted Primers PCR Primer
(F):5'- GTGGCAGACTCTCAATGACTGAC -3'
(R):5'- AGCAAGTCAGAGTCAGACGC -3'

Sequencing Primer
(F):5'- TCTCAATGACTGACACTTCCAGGG -3'
(R):5'- CAGAGTCAGACGCTAGTTCCTTAG -3'
Posted On2016-04-27