Incidental Mutation 'R4946:Mtmr6'
ID383449
Institutional Source Beutler Lab
Gene Symbol Mtmr6
Ensembl Gene ENSMUSG00000021987
Gene Namemyotubularin related protein 6
Synonyms4022440C11Rik
MMRRC Submission 042543-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4946 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location60265228-60302370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60280189 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 83 (P83L)
Ref Sequence ENSEMBL: ENSMUSP00000153403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022563] [ENSMUST00000224366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022563
AA Change: P83L

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022563
Gene: ENSMUSG00000021987
AA Change: P83L

DomainStartEndE-ValueType
Pfam:Myotub-related 107 446 1.3e-143 PFAM
coiled coil region 510 548 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224366
AA Change: P83L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225574
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,086,474 D98G probably damaging Het
Adgre1 G A 17: 57,443,918 V531I probably benign Het
Aldoart2 A G 12: 55,566,016 Q242R probably benign Het
Ank2 A T 3: 126,941,940 probably benign Het
Ank3 C T 10: 69,898,117 A737V probably damaging Het
Ankle2 A G 5: 110,253,838 I789V probably benign Het
Ankrd13c T C 3: 158,005,773 V510A probably damaging Het
Arid1b T A 17: 5,342,843 M2216K probably damaging Het
Arrdc1 A G 2: 24,925,848 V380A probably benign Het
B3galt1 C A 2: 68,118,569 N209K possibly damaging Het
Cd300c2 A T 11: 114,996,905 C224S probably benign Het
Cdk4 T C 10: 127,064,890 probably null Het
Cdk5rap1 T C 2: 154,368,874 T115A possibly damaging Het
Clvs1 A T 4: 9,281,831 R92* probably null Het
Cnga1 A G 5: 72,604,764 V469A probably damaging Het
Ctns A G 11: 73,196,653 F16L probably benign Het
Dlg5 A T 14: 24,154,361 C1299S probably damaging Het
Dnah3 T A 7: 119,931,560 Y3690F probably damaging Het
Dnah5 A G 15: 28,326,557 M1971V probably damaging Het
Dnah5 G A 15: 28,387,904 V3170M probably damaging Het
Dpp8 T C 9: 65,055,918 Y485H probably benign Het
Dsc2 T C 18: 20,050,157 D68G probably damaging Het
Elavl1 A T 8: 4,301,752 D121E probably benign Het
Ermap A G 4: 119,183,308 V311A probably damaging Het
Fam102b A G 3: 108,980,228 V240A probably benign Het
Fbxw11 C T 11: 32,739,226 R437C probably damaging Het
Gas2l3 T C 10: 89,413,772 M495V probably benign Het
Hacd1 C T 2: 14,045,137 probably null Het
Itgav A G 2: 83,788,983 R596G probably benign Het
Kars T C 8: 112,001,720 H215R possibly damaging Het
Kif26a G A 12: 112,177,794 R1494H probably damaging Het
Klf12 G A 14: 100,022,957 S112L possibly damaging Het
Krt77 T C 15: 101,869,563 Y19C unknown Het
Lrrc4c A G 2: 97,630,489 T487A probably benign Het
Lrrn1 A G 6: 107,568,890 M550V probably benign Het
Lsr C A 7: 30,958,209 R442L probably benign Het
Lysmd2 A C 9: 75,635,446 T112P probably damaging Het
Mctp2 A T 7: 72,259,269 S99T probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mill2 T A 7: 18,856,683 probably null Het
Mpp3 T C 11: 102,005,022 N476D probably benign Het
Myh3 T C 11: 67,093,538 I1067T probably benign Het
Myh9 C A 15: 77,773,340 Q1068H probably damaging Het
Narf T A 11: 121,250,353 H304Q possibly damaging Het
Nfatc2ip G T 7: 126,396,612 P35Q possibly damaging Het
Npas3 C A 12: 54,065,835 P426Q probably damaging Het
Olfr1289 T C 2: 111,483,966 Y207H possibly damaging Het
Olfr1508 G A 14: 52,463,283 T242I probably damaging Het
Olfr432 T G 1: 174,050,834 S154A possibly damaging Het
Olfr467 A G 7: 107,815,382 H266R possibly damaging Het
Olfr640 T A 7: 104,022,012 Q102L probably damaging Het
Pcdh10 A T 3: 45,379,482 E77V probably damaging Het
Pcnt C T 10: 76,356,185 R2764Q probably damaging Het
Pgbd5 T C 8: 124,370,585 D493G possibly damaging Het
Piezo2 G T 18: 63,157,262 T142N probably benign Het
Plcb1 A G 2: 135,345,095 I761V probably benign Het
Plekhg4 T G 8: 105,381,996 D1196E probably null Het
Pparg A G 6: 115,451,028 K159E probably damaging Het
Psmb1 A T 17: 15,498,216 M16K probably benign Het
Ptprq T C 10: 107,525,734 I2139V probably benign Het
Ralgapb T A 2: 158,440,967 S239T probably damaging Het
Serpina11 A G 12: 103,984,664 V266A probably damaging Het
Sf3a2 C G 10: 80,804,113 probably benign Het
Smim18 T C 8: 33,742,559 T11A possibly damaging Het
Snx6 G A 12: 54,770,743 T7I probably damaging Het
Srcin1 T A 11: 97,551,942 D75V probably damaging Het
Srsf12 T A 4: 33,231,174 S223T probably damaging Het
Taf4b G T 18: 14,813,542 C474F probably damaging Het
Tango6 T A 8: 106,718,090 C542* probably null Het
Tbc1d24 A G 17: 24,208,536 S151P possibly damaging Het
Tssk6 T C 8: 69,903,064 S253P probably benign Het
Ttc39c G A 18: 12,724,942 W300* probably null Het
Ttc6 T A 12: 57,643,140 W539R probably benign Het
Ttn T C 2: 76,752,426 T22708A probably damaging Het
Ttn C A 2: 76,918,709 E3999* probably null Het
Vill T G 9: 119,068,440 L261R probably damaging Het
Vmn1r20 T C 6: 57,432,174 S162P probably damaging Het
Zfp516 T C 18: 82,956,094 I139T probably benign Het
Other mutations in Mtmr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Mtmr6 APN 14 60280217 nonsense probably null
IGL01377:Mtmr6 APN 14 60282034 nonsense probably null
IGL02579:Mtmr6 APN 14 60281929 splice site probably benign
IGL02598:Mtmr6 APN 14 60300504 missense probably damaging 1.00
IGL03007:Mtmr6 APN 14 60289535 splice site probably benign
Chilly UTSW 14 60292129 splice site probably null
IGL03046:Mtmr6 UTSW 14 60292128 critical splice donor site probably null
R0542:Mtmr6 UTSW 14 60292129 splice site probably null
R0577:Mtmr6 UTSW 14 60296638 missense possibly damaging 0.67
R1845:Mtmr6 UTSW 14 60296735 missense probably damaging 1.00
R1999:Mtmr6 UTSW 14 60293407 missense probably damaging 1.00
R2018:Mtmr6 UTSW 14 60298992 missense probably benign
R2019:Mtmr6 UTSW 14 60298992 missense probably benign
R2078:Mtmr6 UTSW 14 60291987 splice site probably null
R2120:Mtmr6 UTSW 14 60296659 missense probably damaging 1.00
R3743:Mtmr6 UTSW 14 60300298 missense probably benign 0.02
R4739:Mtmr6 UTSW 14 60292097 missense probably damaging 1.00
R5603:Mtmr6 UTSW 14 60285001 nonsense probably null
R6056:Mtmr6 UTSW 14 60298170 missense probably damaging 1.00
R6489:Mtmr6 UTSW 14 60300514 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAGGCATTGCAATGTGTTAAATGTG -3'
(R):5'- GGGGTTTGCCTGTACATATGAAC -3'

Sequencing Primer
(F):5'- GCAATGTGTTAAATGTGATAGCACC -3'
(R):5'- GGTTTGCCTGTACATATGAACCTAAC -3'
Posted On2016-04-27