Incidental Mutation 'R4947:D630045J12Rik'
ID383490
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene NameRIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission 042544-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4947 (G1)
Quality Score128
Status Validated
Chromosome6
Chromosomal Location38123174-38254009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38148543 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1512 (R1512H)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
Predicted Effect probably damaging
Transcript: ENSMUST00000117556
AA Change: R1371H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: R1371H

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149557
Predicted Effect probably damaging
Transcript: ENSMUST00000169256
AA Change: R1512H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: R1512H

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,357,614 H119L probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Adamtsl1 A T 4: 85,764,800 Q36L possibly damaging Het
Als2cr12 T A 1: 58,676,539 T173S probably benign Het
BC117090 T C 16: 36,321,765 Y83C probably damaging Het
Bcl2a1a G A 9: 88,957,282 E78K probably damaging Het
C130026I21Rik G A 1: 85,112,482 A124V probably damaging Het
Cdk5rap2 A G 4: 70,228,592 probably null Het
Copg1 C A 6: 87,903,473 probably benign Het
Crb2 C T 2: 37,795,331 probably benign Het
Ctbp2 C A 7: 132,999,283 G584C probably damaging Het
Cyp11b2 T C 15: 74,851,570 N415S possibly damaging Het
D630003M21Rik T A 2: 158,186,196 T1095S unknown Het
Dnah5 T A 15: 28,272,372 V1078E probably benign Het
Donson A T 16: 91,682,551 D366E probably damaging Het
Evpl T C 11: 116,223,375 E1163G possibly damaging Het
Fcgbp A G 7: 28,089,812 K601R probably benign Het
Fez1 A C 9: 36,868,875 I323L probably damaging Het
Fmnl2 T G 2: 53,073,710 S285A probably benign Het
Frem1 A G 4: 82,966,134 S1194P probably damaging Het
Gm10754 A T 10: 97,682,148 probably benign Het
Gm14226 A T 2: 155,024,959 T279S probably benign Het
Gm16332 G A 1: 139,865,992 noncoding transcript Het
Gm21718 T A 14: 51,315,959 noncoding transcript Het
Gm9866 A T 12: 27,160,228 noncoding transcript Het
Gm9871 A G 6: 101,796,773 noncoding transcript Het
Grm1 A G 10: 10,782,633 F371S probably damaging Het
Gtdc1 T C 2: 44,591,956 I128V probably null Het
H2-Q3 T A 17: 35,359,732 noncoding transcript Het
Ibtk T C 9: 85,710,412 T998A probably benign Het
Ifi204 A G 1: 173,755,750 S301P probably damaging Het
Kcnn1 C A 8: 70,844,429 A545S probably benign Het
Keap1 T G 9: 21,237,553 S53R probably benign Het
Lat A G 7: 126,367,938 V138A probably benign Het
Lrpprc A T 17: 84,771,538 N249K probably benign Het
Lrrc40 A G 3: 158,063,835 I557V probably benign Het
Maml3 A G 3: 51,856,539 F335L probably benign Het
Mcmbp A T 7: 128,712,696 D265E probably damaging Het
Me3 A G 7: 89,633,014 H35R probably benign Het
Mif4gd C A 11: 115,609,637 V32L probably benign Het
Mlana T C 19: 29,700,151 S18P probably damaging Het
Mpnd T A 17: 56,010,268 probably benign Het
Ms4a4b T C 19: 11,454,737 V74A probably benign Het
Mta2 T C 19: 8,946,291 F133L possibly damaging Het
Myo5a A G 9: 75,123,048 M150V probably damaging Het
Nbr1 T C 11: 101,575,077 V487A probably benign Het
Nos3 G A 5: 24,377,855 C660Y probably damaging Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Olfr109 T C 17: 37,466,743 V179A probably damaging Het
Olfr186 A G 16: 59,027,445 L154P probably damaging Het
Olfr376 C T 11: 73,375,417 R223* probably null Het
Olfr669 A G 7: 104,938,742 D72G possibly damaging Het
Pcdh7 A G 5: 57,721,916 K938E probably damaging Het
Pcgf3 T C 5: 108,487,961 F166L probably benign Het
Pid1 A T 1: 84,038,260 V128E possibly damaging Het
Polr3a A C 14: 24,482,464 D187E probably benign Het
Prokr2 T C 2: 132,373,653 D135G probably damaging Het
Rnf141 T C 7: 110,825,320 T14A possibly damaging Het
Serinc1 T C 10: 57,523,045 E254G probably damaging Het
Skint11 T C 4: 114,191,510 F11L possibly damaging Het
Slc22a28 T C 19: 8,131,452 T109A probably benign Het
Sntg1 C A 1: 8,782,798 V43L probably damaging Het
Strn T C 17: 78,661,779 D398G probably damaging Het
Tacc2 A T 7: 130,625,899 E1438V probably damaging Het
Tas2r139 A G 6: 42,141,566 T211A possibly damaging Het
Tbkbp1 T C 11: 97,138,944 probably benign Het
Thbs3 T C 3: 89,226,431 Y897H probably damaging Het
Timm50 G T 7: 28,310,044 probably benign Het
Tmem132a T C 19: 10,866,934 Q100R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Unc93b1 C A 19: 3,935,871 T90K probably benign Het
Upk3bl T C 5: 136,057,245 probably benign Het
Vmn2r112 T A 17: 22,602,879 H179Q probably benign Het
Vmn2r57 A T 7: 41,400,495 F610Y probably damaging Het
Vmn2r80 T G 10: 79,194,698 L786R probably damaging Het
Zc3h14 A G 12: 98,759,824 T323A probably benign Het
Zfp532 T C 18: 65,625,066 I690T possibly damaging Het
Zfp729b T C 13: 67,596,672 N47S probably damaging Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38194930 missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38136963 missense probably benign
IGL01745:D630045J12Rik APN 6 38191720 missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38184072 missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38196394 missense probably benign
IGL02496:D630045J12Rik APN 6 38149705 missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38195485 missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38149713 missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38168221 missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38147259 missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38178839 missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38195101 missense probably benign
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0128:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0130:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0206:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38181392 missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38196736 missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38191693 missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38196778 missense probably benign
R0842:D630045J12Rik UTSW 6 38148465 missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38194770 missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38195760 missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38190655 missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38181431 missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38139427 missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38174147 critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38158091 missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38168171 missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38142909 missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38142698 missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38194761 missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38196657 missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38196036 missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38196841 missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38148340 missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38194485 missense possibly damaging 0.90
R4959:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38194620 missense probably benign
R5344:D630045J12Rik UTSW 6 38158228 missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38191764 missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38196367 missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38142657 missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38194969 missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38190617 missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38130864 missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38142698 missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38147197 nonsense probably null
R6930:D630045J12Rik UTSW 6 38158216 missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38194635 missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38195029 missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38168263 missense probably damaging 1.00
R7249:D630045J12Rik UTSW 6 38136950 missense possibly damaging 0.95
R7250:D630045J12Rik UTSW 6 38142611 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TATGAACACAGAGGGCACAC -3'
(R):5'- ATGGATGGATGGCTTCCTGC -3'

Sequencing Primer
(F):5'- ACAGAGGGCACACTGGCTG -3'
(R):5'- TTCCTGCCACTCAGTAGGCAG -3'
Posted On2016-04-27