Mutagenetix > Incidental Mutation

Incidental Mutation 'R4949:Ift140'

383684

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

042546-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4949 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25235056-25318461 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25313639 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1357 (S1357T)

Ref Sequence

ENSEMBL: ENSMUSP00000024983 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000024987] [ENSMUST00000115181] [ENSMUST00000137386]

AlphaFold

E9PY46

Predicted Effect

probably benign
Transcript: ENSMUST00000024983
AA Change: S1357T

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: S1357T

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000024987

SMART Domains

Protein: ENSMUSP00000024987
Gene: ENSMUSG00000024170

Domain	Start	End	E-Value	Type
Pfam:Telomere_reg-2	513	621	3.8e-38	PFAM
low complexity region	771	782	N/A	INTRINSIC
low complexity region	816	837	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115181

SMART Domains

Protein: ENSMUSP00000110835
Gene: ENSMUSG00000024170

Domain	Start	End	E-Value	Type
Pfam:Telomere_reg-2	513	621	3.8e-38	PFAM
low complexity region	771	782	N/A	INTRINSIC
low complexity region	816	837	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137386

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139300

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155632

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155607

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	T	C	5: 35,769,450 (GRCm39)	V692A	probably benign	Het
Bcl2l13	G	T	6: 120,864,191 (GRCm39)	G382W	probably damaging	Het
Cdhr5	T	A	7: 140,852,557 (GRCm39)	N353I	probably damaging	Het
Chil4	A	G	3: 106,113,408 (GRCm39)	S170P	possibly damaging	Het
Clp1	A	C	2: 84,554,086 (GRCm39)	M361R	possibly damaging	Het
Cylc2	A	G	4: 51,229,804 (GRCm39)	K382R	unknown	Het
Dsg2	T	A	18: 20,723,241 (GRCm39)	D422E	probably damaging	Het
Dync1h1	C	A	12: 110,624,560 (GRCm39)	T3700N	probably damaging	Het
Gm14295	A	C	2: 176,501,469 (GRCm39)	T320P	probably damaging	Het
Ido2	T	G	8: 25,023,970 (GRCm39)		probably null	Het
Insr	T	G	8: 3,235,059 (GRCm39)	E145A	probably benign	Het
Itpripl1	A	G	2: 126,983,327 (GRCm39)	M265T	probably benign	Het
Kcnb1	G	T	2: 166,947,521 (GRCm39)	N442K	probably damaging	Het
Kifc5b	C	A	17: 27,144,488 (GRCm39)	R536S	probably damaging	Het
Klf6	A	T	13: 5,914,947 (GRCm39)	S129C	probably benign	Het
Lpin2	C	G	17: 71,538,334 (GRCm39)	P327A	probably damaging	Het
Lsm1	T	C	8: 26,292,065 (GRCm39)	V114A	probably benign	Het
Map7d1	C	T	4: 126,128,846 (GRCm39)	W218*	probably null	Het
N4bp2	T	A	5: 65,979,142 (GRCm39)		probably null	Het
Nt5el	T	A	13: 105,246,214 (GRCm39)	S258R	probably damaging	Het
Rheb	A	T	5: 25,008,729 (GRCm39)	I163K	possibly damaging	Het
Rph3a	T	C	5: 121,101,897 (GRCm39)	D113G	probably damaging	Het
Scn8a	A	G	15: 100,927,663 (GRCm39)	N1381D	probably damaging	Het
Sdsl	T	A	5: 120,597,870 (GRCm39)	N208Y	possibly damaging	Het
Serpinb9e	A	G	13: 33,435,591 (GRCm39)	N8S	possibly damaging	Het
Sox18	G	A	2: 181,313,017 (GRCm39)	Q100*	probably null	Het
Taar8b	C	T	10: 23,967,825 (GRCm39)	C123Y	probably damaging	Het
Tas2r124	A	G	6: 132,731,858 (GRCm39)	I56V	possibly damaging	Het
Tes	C	A	6: 17,100,359 (GRCm39)	H331N	probably benign	Het
Tmbim1	T	G	1: 74,334,524 (GRCm39)	D12A	probably damaging	Het
Tmprss4	T	C	9: 45,086,841 (GRCm39)	I307V	possibly damaging	Het
Ttll1	A	T	15: 83,386,374 (GRCm39)	M77K	probably null	Het
Ttpal	G	A	2: 163,455,671 (GRCm39)	R220Q	probably damaging	Het
Vmn1r230	T	A	17: 21,067,625 (GRCm39)	H271Q	probably benign	Het
Vmn2r32	A	G	7: 7,467,083 (GRCm39)	I815T	probably benign	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25,274,618 (GRCm39)	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25,237,776 (GRCm39)	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25,267,429 (GRCm39)	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25,313,676 (GRCm39)	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25,305,999 (GRCm39)	splice site	probably null
IGL01994:Ift140	APN	17	25,267,417 (GRCm39)	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25,252,104 (GRCm39)	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25,274,572 (GRCm39)	missense	probably benign
IGL02493:Ift140	APN	17	25,306,898 (GRCm39)	nonsense	probably null
IGL02735:Ift140	APN	17	25,253,009 (GRCm39)	splice site	probably benign
IGL02902:Ift140	APN	17	25,309,736 (GRCm39)	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25,311,368 (GRCm39)	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25,305,884 (GRCm39)	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25,311,800 (GRCm39)	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25,306,880 (GRCm39)	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25,306,958 (GRCm39)	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25,305,834 (GRCm39)	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25,309,928 (GRCm39)	nonsense	probably null
R0100:Ift140	UTSW	17	25,309,928 (GRCm39)	nonsense	probably null
R0197:Ift140	UTSW	17	25,309,907 (GRCm39)	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25,264,497 (GRCm39)	nonsense	probably null
R0238:Ift140	UTSW	17	25,264,497 (GRCm39)	nonsense	probably null
R0239:Ift140	UTSW	17	25,264,497 (GRCm39)	nonsense	probably null
R0239:Ift140	UTSW	17	25,264,497 (GRCm39)	nonsense	probably null
R0355:Ift140	UTSW	17	25,267,409 (GRCm39)	nonsense	probably null
R0399:Ift140	UTSW	17	25,269,314 (GRCm39)	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25,270,734 (GRCm39)	splice site	probably null
R0610:Ift140	UTSW	17	25,254,777 (GRCm39)	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25,309,907 (GRCm39)	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25,309,907 (GRCm39)	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25,254,786 (GRCm39)	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25,254,719 (GRCm39)	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25,307,907 (GRCm39)	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25,306,959 (GRCm39)	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25,307,839 (GRCm39)	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25,244,608 (GRCm39)	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25,254,813 (GRCm39)	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25,239,710 (GRCm39)	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25,255,282 (GRCm39)	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25,254,805 (GRCm39)	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25,255,282 (GRCm39)	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25,247,918 (GRCm39)	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25,309,741 (GRCm39)	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25,317,935 (GRCm39)	unclassified	probably benign
R4711:Ift140	UTSW	17	25,313,691 (GRCm39)	splice site	probably null
R4934:Ift140	UTSW	17	25,267,462 (GRCm39)	missense	probably benign
R4982:Ift140	UTSW	17	25,255,968 (GRCm39)	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25,309,674 (GRCm39)	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25,254,786 (GRCm39)	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25,239,601 (GRCm39)	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25,252,059 (GRCm39)	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25,239,550 (GRCm39)	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25,264,038 (GRCm39)	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25,247,787 (GRCm39)	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25,308,514 (GRCm39)	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25,252,893 (GRCm39)	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25,311,345 (GRCm39)	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25,313,735 (GRCm39)	nonsense	probably null
R6000:Ift140	UTSW	17	25,255,934 (GRCm39)	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25,274,563 (GRCm39)	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25,309,979 (GRCm39)	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25,312,100 (GRCm39)	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25,247,946 (GRCm39)	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25,269,408 (GRCm39)	missense	probably benign
R6539:Ift140	UTSW	17	25,313,643 (GRCm39)	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25,251,147 (GRCm39)	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25,252,090 (GRCm39)	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25,317,890 (GRCm39)	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25,239,520 (GRCm39)	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25,274,699 (GRCm39)	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25,239,619 (GRCm39)	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25,256,010 (GRCm39)	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25,252,089 (GRCm39)	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25,311,315 (GRCm39)	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25,270,798 (GRCm39)	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25,255,949 (GRCm39)	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25,311,889 (GRCm39)	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25,313,651 (GRCm39)	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25,254,809 (GRCm39)	missense	probably benign
R8932:Ift140	UTSW	17	25,305,862 (GRCm39)	missense	probably benign	0.03
R9226:Ift140	UTSW	17	25,317,839 (GRCm39)	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25,313,753 (GRCm39)	missense	probably benign	0.00
R9451:Ift140	UTSW	17	25,252,925 (GRCm39)	missense	probably benign	0.33
R9456:Ift140	UTSW	17	25,254,758 (GRCm39)	missense	probably benign	0.03
R9782:Ift140	UTSW	17	25,264,151 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCACCATTCTAGGCAATTGTCCAC -3'
(R):5'- GTTAGCTTGTCACCTCAAAGGAAATAG -3'

Sequencing Primer
(F):5'- TTCTAGGCAATTGTCCACAGACC -3'
(R):5'- GTATAGTAAGTCTTTCAAGAACCAGG -3'

Posted On

2016-04-27