Incidental Mutation 'R0345:Olfr992'
ID38369
Institutional Source Beutler Lab
Gene Symbol Olfr992
Ensembl Gene ENSMUSG00000075221
Gene Nameolfactory receptor 992
SynonymsMOR203-1, GA_x6K02T2Q125-46877170-46876241
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R0345 (G1)
Quality Score212
Status Validated
Chromosome2
Chromosomal Location85398824-85409469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85400341 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 64 (Q64R)
Ref Sequence ENSEMBL: ENSMUSP00000149333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099927] [ENSMUST00000213749] [ENSMUST00000214895] [ENSMUST00000215617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099927
AA Change: Q64R

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097511
Gene: ENSMUSG00000075221
AA Change: Q64R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 285 3.3e-6 PFAM
Pfam:7tm_1 41 290 7.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213749
AA Change: Q64R

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214895
AA Change: Q64R

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000215617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215967
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Adgrb1 A G 15: 74,543,349 N641S probably damaging Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Ap2a2 T A 7: 141,631,293 M914K probably damaging Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Chrnb4 A G 9: 55,035,594 V132A probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Cyp2d37-ps A T 15: 82,689,774 noncoding transcript Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Llgl2 A G 11: 115,849,992 probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myo5c A G 9: 75,297,419 E1518G probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr670 T A 7: 104,960,181 M184L probably damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sntb2 T C 8: 107,001,538 S373P probably damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stap2 A G 17: 56,000,097 V217A probably damaging Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Synm C T 7: 67,735,821 V256I probably benign Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Zyg11b A G 4: 108,266,407 I121T probably damaging Het
Other mutations in Olfr992
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr992 APN 2 85400171 missense probably damaging 1.00
IGL02538:Olfr992 APN 2 85400303 missense probably damaging 1.00
IGL02550:Olfr992 APN 2 85399822 missense probably damaging 0.99
R0128:Olfr992 UTSW 2 85399961 missense probably damaging 0.99
R0130:Olfr992 UTSW 2 85399961 missense probably damaging 0.99
R0413:Olfr992 UTSW 2 85399675 missense probably damaging 1.00
R0535:Olfr992 UTSW 2 85400095 missense possibly damaging 0.71
R1243:Olfr992 UTSW 2 85400273 missense probably benign
R1255:Olfr992 UTSW 2 85400303 missense probably damaging 1.00
R1293:Olfr992 UTSW 2 85400353 splice site probably null
R1840:Olfr992 UTSW 2 85400168 missense probably benign 0.42
R1847:Olfr992 UTSW 2 85400441 missense probably damaging 0.99
R2300:Olfr992 UTSW 2 85400132 missense probably benign
R4574:Olfr992 UTSW 2 85400026 missense probably damaging 1.00
R4872:Olfr992 UTSW 2 85400428 missense probably damaging 1.00
R5435:Olfr992 UTSW 2 85400470 missense probably benign 0.05
R6846:Olfr992 UTSW 2 85400517 missense probably damaging 1.00
R7075:Olfr992 UTSW 2 85400200 missense not run
Predicted Primers PCR Primer
(F):5'- CCCATAGTGTATGAACCAAGCAGCAG -3'
(R):5'- CCTGGGATTCGCTGGTCAAAATGAG -3'

Sequencing Primer
(F):5'- TCTCTGGGACATGATAATAGGATAGC -3'
(R):5'- CTGGTCAAAATGAGTCTTGGCAC -3'
Posted On2013-05-23