Incidental Mutation 'R4963:Polrmt'
ID383730
Institutional Source Beutler Lab
Gene Symbol Polrmt
Ensembl Gene ENSMUSG00000020329
Gene Namepolymerase (RNA) mitochondrial (DNA directed)
Synonyms
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R4963 (G1)
Quality Score85
Status Validated
Chromosome10
Chromosomal Location79736123-79746581 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 79746551 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000124556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020580] [ENSMUST00000159016] [ENSMUST00000162694]
Predicted Effect probably null
Transcript: ENSMUST00000020580
AA Change: M1T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020580
Gene: ENSMUSG00000020329
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 802 1207 5.6e-169 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159016
AA Change: M1T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124936
Gene: ENSMUSG00000020329
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 601 6.27e-50 SMART
low complexity region 629 640 N/A INTRINSIC
Pfam:RNA_pol 727 1133 7.5e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161765
Predicted Effect probably null
Transcript: ENSMUST00000162694
AA Change: M1T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124556
Gene: ENSMUSG00000020329
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 801 895 6.4e-34 PFAM
Meta Mutation Damage Score 0.57 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial DNA-directed RNA polymerase. The gene product is responsible for mitochondrial gene expression as well as for providing RNA primers for initiation of replication of the mitochondrial genome. Although this polypeptide has the same function as the three nuclear DNA-directed RNA polymerases, it is more closely related to RNA polymerases of phage and mitochondrial polymerases of lower eukaryotes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die before organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Abcg5 G T 17: 84,660,141 Y410* probably null Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Arhgap17 T C 7: 123,308,360 R260G possibly damaging Het
Atp1a3 T C 7: 24,994,626 T381A probably damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
Gtpbp4 C A 13: 8,985,217 D369Y probably damaging Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Kirrel2 C A 7: 30,450,801 probably null Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Ldb3 T G 14: 34,566,858 S252R probably damaging Het
March8 G A 6: 116,386,271 probably benign Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Nedd1 C A 10: 92,695,031 D399Y probably damaging Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Olfr1366 A G 13: 21,537,982 Y8H probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Prmt9 A G 8: 77,555,729 D85G probably damaging Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Spata18 T A 5: 73,678,993 V419E probably damaging Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in Polrmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Polrmt APN 10 79737597 splice site probably null
IGL01145:Polrmt APN 10 79741137 missense probably benign 0.12
IGL01454:Polrmt APN 10 79743683 missense possibly damaging 0.60
IGL01511:Polrmt APN 10 79740151 missense probably benign 0.00
IGL01750:Polrmt APN 10 79739846 missense possibly damaging 0.84
IGL01766:Polrmt APN 10 79736568 missense possibly damaging 0.71
IGL01827:Polrmt APN 10 79738120 missense probably damaging 1.00
IGL02941:Polrmt APN 10 79737258 splice site probably benign
IGL02982:Polrmt APN 10 79738348 missense probably damaging 1.00
R0323:Polrmt UTSW 10 79741998 missense probably benign 0.41
R0379:Polrmt UTSW 10 79737611 missense possibly damaging 0.89
R0628:Polrmt UTSW 10 79739145 missense possibly damaging 0.89
R1017:Polrmt UTSW 10 79743509 nonsense probably null
R1846:Polrmt UTSW 10 79738209 missense probably damaging 1.00
R2082:Polrmt UTSW 10 79743512 missense probably benign 0.41
R2149:Polrmt UTSW 10 79740275 nonsense probably null
R2359:Polrmt UTSW 10 79736562 missense probably damaging 1.00
R4105:Polrmt UTSW 10 79741733 missense probably benign
R4381:Polrmt UTSW 10 79741808 missense possibly damaging 0.94
R4782:Polrmt UTSW 10 79739523 missense probably benign 0.04
R4902:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4904:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4916:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4938:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4964:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4970:Polrmt UTSW 10 79736587 missense probably damaging 1.00
R5177:Polrmt UTSW 10 79737476 missense probably benign 0.04
R5484:Polrmt UTSW 10 79742054 missense probably damaging 1.00
R5820:Polrmt UTSW 10 79738323 splice site probably null
R5910:Polrmt UTSW 10 79743497 missense probably benign 0.03
R5928:Polrmt UTSW 10 79740352 missense probably damaging 1.00
R6550:Polrmt UTSW 10 79739680 missense probably damaging 1.00
R6979:Polrmt UTSW 10 79746566 utr 5 prime probably null
R7323:Polrmt UTSW 10 79740649 missense probably benign
X0026:Polrmt UTSW 10 79740740 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GACCTAGAGAGACGTTGCCAAC -3'
(R):5'- AGAGTATTTCTGCGCATGCTCTC -3'

Sequencing Primer
(F):5'- AGACGTTGCCAACTAGTGC -3'
(R):5'- GCGCATGCTCTCTTGCCG -3'
Posted On2016-04-27