Incidental Mutation 'R4963:Nedd1'
ID383731
Institutional Source Beutler Lab
Gene Symbol Nedd1
Ensembl Gene ENSMUSG00000019988
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 1
Synonyms
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R4963 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location92684746-92722420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92695031 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 399 (D399Y)
Ref Sequence ENSEMBL: ENSMUSP00000020163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020163]
Predicted Effect probably damaging
Transcript: ENSMUST00000020163
AA Change: D399Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988
AA Change: D399Y

DomainStartEndE-ValueType
WD40 21 63 5.97e-1 SMART
WD40 67 105 9.75e-3 SMART
WD40 108 147 6.19e-5 SMART
WD40 149 191 6.42e-1 SMART
WD40 194 235 9.1e-3 SMART
WD40 238 276 2.24e-2 SMART
low complexity region 555 568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214417
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Abcg5 G T 17: 84,660,141 Y410* probably null Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Arhgap17 T C 7: 123,308,360 R260G possibly damaging Het
Atp1a3 T C 7: 24,994,626 T381A probably damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
Gtpbp4 C A 13: 8,985,217 D369Y probably damaging Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Kirrel2 C A 7: 30,450,801 probably null Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Ldb3 T G 14: 34,566,858 S252R probably damaging Het
March8 G A 6: 116,386,271 probably benign Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Olfr1366 A G 13: 21,537,982 Y8H probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prmt9 A G 8: 77,555,729 D85G probably damaging Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Spata18 T A 5: 73,678,993 V419E probably damaging Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in Nedd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Nedd1 APN 10 92694974 splice site probably benign
IGL00988:Nedd1 APN 10 92689686 missense possibly damaging 0.71
IGL01563:Nedd1 APN 10 92698169 critical splice donor site probably null
IGL01588:Nedd1 APN 10 92686262 missense probably benign 0.12
IGL01988:Nedd1 APN 10 92714159 missense probably benign 0.39
IGL02706:Nedd1 APN 10 92686285 missense possibly damaging 0.88
IGL02938:Nedd1 APN 10 92689657 nonsense probably null
IGL03011:Nedd1 APN 10 92689641 missense possibly damaging 0.92
Brainless UTSW 10 92690773 missense probably benign 0.01
R0125:Nedd1 UTSW 10 92691929 missense possibly damaging 0.93
R0173:Nedd1 UTSW 10 92698883 missense probably benign 0.30
R0244:Nedd1 UTSW 10 92716265 intron probably benign
R0645:Nedd1 UTSW 10 92691831 splice site probably null
R0791:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1490:Nedd1 UTSW 10 92700798 missense probably damaging 1.00
R1522:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1797:Nedd1 UTSW 10 92698739 missense possibly damaging 0.46
R1984:Nedd1 UTSW 10 92714160 missense possibly damaging 0.63
R2474:Nedd1 UTSW 10 92719603 missense probably damaging 0.99
R2877:Nedd1 UTSW 10 92714126 missense possibly damaging 0.89
R2883:Nedd1 UTSW 10 92694998 missense probably damaging 0.98
R4694:Nedd1 UTSW 10 92719582 missense probably benign 0.00
R4798:Nedd1 UTSW 10 92698910 missense probably benign 0.00
R4830:Nedd1 UTSW 10 92686258 missense probably damaging 1.00
R5174:Nedd1 UTSW 10 92711212 missense possibly damaging 0.77
R5329:Nedd1 UTSW 10 92686240 missense probably damaging 1.00
R5404:Nedd1 UTSW 10 92716192 missense probably benign 0.04
R5534:Nedd1 UTSW 10 92695032 missense probably benign 0.01
R6045:Nedd1 UTSW 10 92695100 nonsense probably null
R6154:Nedd1 UTSW 10 92698242 missense possibly damaging 0.65
R6512:Nedd1 UTSW 10 92691875 missense probably benign
R6692:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6693:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6943:Nedd1 UTSW 10 92711306 missense probably damaging 1.00
R7011:Nedd1 UTSW 10 92690773 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGGGATTGGAACCATGTAC -3'
(R):5'- TAAACTTGCACCAGGGTGGG -3'

Sequencing Primer
(F):5'- CCATGTACAGTGACTAGCATTTGC -3'
(R):5'- ACCAGGGTGGGTAATGTCCATTTTAC -3'
Posted On2016-04-27