Incidental Mutation 'R4963:Gtpbp4'
ID383739
Institutional Source Beutler Lab
Gene Symbol Gtpbp4
Ensembl Gene ENSMUSG00000021149
Gene NameGTP binding protein 4
SynonymsNog1, 2610028C09Rik, Crfg
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4963 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location8966331-8996083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8985217 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 369 (D369Y)
Ref Sequence ENSEMBL: ENSMUSP00000152412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021574] [ENSMUST00000222098]
Predicted Effect probably benign
Transcript: ENSMUST00000021574
SMART Domains Protein: ENSMUSP00000021574
Gene: ENSMUSG00000021149

DomainStartEndE-ValueType
Pfam:FeoB_N 169 335 4.7e-13 PFAM
Pfam:MMR_HSR1 170 290 1.7e-18 PFAM
Pfam:NOG1 235 292 1.3e-29 PFAM
Pfam:NOGCT 395 446 1.4e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 467 479 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
low complexity region 560 575 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221534
Predicted Effect probably damaging
Transcript: ENSMUST00000222098
AA Change: D369Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.474 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP-binding proteins are GTPases and function as molecular switches that can flip between two states: active, when GTP is bound, and inactive, when GDP is bound. 'Active' in this context usually means that the molecule acts as a signal to trigger other events in the cell. When an extracellular ligand binds to a G-protein-linked receptor, the receptor changes its conformation and switches on the trimeric G proteins that associate with it by causing them to eject their GDP and replace it with GTP. The switch is turned off when the G protein hydrolyzes its own bound GTP, converting it back to GDP. But before that occurs, the active protein has an opportunity to diffuse away from the receptor and deliver its message for a prolonged period to its downstream target. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Abcg5 G T 17: 84,660,141 Y410* probably null Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Arhgap17 T C 7: 123,308,360 R260G possibly damaging Het
Atp1a3 T C 7: 24,994,626 T381A probably damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Kirrel2 C A 7: 30,450,801 probably null Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Ldb3 T G 14: 34,566,858 S252R probably damaging Het
March8 G A 6: 116,386,271 probably benign Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Nedd1 C A 10: 92,695,031 D399Y probably damaging Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Olfr1366 A G 13: 21,537,982 Y8H probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prmt9 A G 8: 77,555,729 D85G probably damaging Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Spata18 T A 5: 73,678,993 V419E probably damaging Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in Gtpbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gtpbp4 APN 13 8977272 missense probably benign
IGL01319:Gtpbp4 APN 13 8985260 missense probably benign 0.05
IGL02108:Gtpbp4 APN 13 8985213 missense probably benign 0.20
IGL02116:Gtpbp4 APN 13 8992736 missense probably damaging 1.00
IGL02406:Gtpbp4 APN 13 8991750 missense possibly damaging 0.81
Atretic UTSW 13 8990737 nonsense probably null
enervated UTSW 13 8989105 missense possibly damaging 0.93
PIT4576001:Gtpbp4 UTSW 13 8991727 missense probably damaging 0.99
R0183:Gtpbp4 UTSW 13 8974961 missense probably benign 0.05
R0571:Gtpbp4 UTSW 13 8990686 splice site probably benign
R1420:Gtpbp4 UTSW 13 8973262 missense probably benign 0.00
R1641:Gtpbp4 UTSW 13 8973249 missense probably benign 0.22
R1840:Gtpbp4 UTSW 13 8979464 missense probably benign 0.00
R1967:Gtpbp4 UTSW 13 8977304 missense probably benign 0.01
R2883:Gtpbp4 UTSW 13 8990723 missense possibly damaging 0.86
R3862:Gtpbp4 UTSW 13 8990798 missense probably damaging 0.99
R4524:Gtpbp4 UTSW 13 8974294 missense probably benign 0.02
R5009:Gtpbp4 UTSW 13 8989066 missense probably benign 0.05
R5555:Gtpbp4 UTSW 13 8979427 critical splice donor site probably null
R5749:Gtpbp4 UTSW 13 8995947 critical splice donor site probably null
R5860:Gtpbp4 UTSW 13 8973160 missense probably benign 0.00
R6449:Gtpbp4 UTSW 13 8990737 nonsense probably null
R6616:Gtpbp4 UTSW 13 8989105 missense possibly damaging 0.93
R7261:Gtpbp4 UTSW 13 8987918 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACACGAGCTTTACTTCCCAC -3'
(R):5'- AATATGTAGGAAGTCAGCCTGTGG -3'

Sequencing Primer
(F):5'- CAAGCATGCGTGACTTTACCATG -3'
(R):5'- AGTGGAGGACTGGATTCTTCC -3'
Posted On2016-04-27