Incidental Mutation 'R4963:Abcg5'
ID383759
Institutional Source Beutler Lab
Gene Symbol Abcg5
Ensembl Gene ENSMUSG00000040505
Gene NameATP binding cassette subfamily G member 5
SynonymsSterolin-1, cmp, trac
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R4963 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84658234-84683011 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 84660141 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 410 (Y410*)
Ref Sequence ENSEMBL: ENSMUSP00000130783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025101] [ENSMUST00000066175] [ENSMUST00000163375]
Predicted Effect probably benign
Transcript: ENSMUST00000025101
SMART Domains Protein: ENSMUSP00000025101
Gene: ENSMUSG00000024253

DomainStartEndE-ValueType
Pfam:DLIC 2 179 3.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000066175
AA Change: Y582*
SMART Domains Protein: ENSMUSP00000069495
Gene: ENSMUSG00000040505
AA Change: Y582*

DomainStartEndE-ValueType
AAA 79 271 2.28e-11 SMART
Pfam:ABC2_membrane 367 581 1.3e-24 PFAM
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163375
AA Change: Y410*
SMART Domains Protein: ENSMUSP00000130783
Gene: ENSMUSG00000040505
AA Change: Y410*

DomainStartEndE-ValueType
Pfam:ABC_tran 1 134 7.8e-17 PFAM
Pfam:ABC2_membrane 195 409 1.4e-23 PFAM
transmembrane domain 449 471 N/A INTRINSIC
Meta Mutation Damage Score 0.656 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily, and functions as a half-transporter to limit intestinal absorption and promote biliary excretion of sterols. Disruption of this gene in mice results in thrombocytopenia, prolonged bleeding times, anemia, leukopenia, infertility, shortened life span and cardiomyopathy. Mice lacking this gene show symptoms of sitosterolemia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show hyperabsorption of dietary plant sterols and sitosterolemia. Spontaneous mutants are small, infertile and hunched and display anemia, leukopenia, macrothrombocytopenia, other hematologic defects, cardiomyopathy, high plasma phytosterol levels and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Arhgap17 T C 7: 123,308,360 R260G possibly damaging Het
Atp1a3 T C 7: 24,994,626 T381A probably damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
Gtpbp4 C A 13: 8,985,217 D369Y probably damaging Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Kirrel2 C A 7: 30,450,801 probably null Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Ldb3 T G 14: 34,566,858 S252R probably damaging Het
March8 G A 6: 116,386,271 probably benign Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Nedd1 C A 10: 92,695,031 D399Y probably damaging Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Olfr1366 A G 13: 21,537,982 Y8H probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prmt9 A G 8: 77,555,729 D85G probably damaging Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Spata18 T A 5: 73,678,993 V419E probably damaging Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in Abcg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Abcg5 APN 17 84664847 missense possibly damaging 0.73
IGL01844:Abcg5 APN 17 84682025 missense probably damaging 1.00
IGL02002:Abcg5 APN 17 84682051 nonsense probably null
IGL02116:Abcg5 APN 17 84673590 missense possibly damaging 0.67
IGL02339:Abcg5 APN 17 84673604 missense possibly damaging 0.95
IGL02568:Abcg5 APN 17 84670399 missense probably damaging 0.99
PIT4142001:Abcg5 UTSW 17 84673594 missense possibly damaging 0.59
R0539:Abcg5 UTSW 17 84669075 missense probably benign 0.01
R1104:Abcg5 UTSW 17 84682049 missense possibly damaging 0.78
R1795:Abcg5 UTSW 17 84673579 missense probably damaging 1.00
R1956:Abcg5 UTSW 17 84670375 missense probably damaging 1.00
R1970:Abcg5 UTSW 17 84673602 frame shift probably null
R2007:Abcg5 UTSW 17 84669920 missense probably damaging 1.00
R2118:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2120:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2121:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2122:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2124:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2858:Abcg5 UTSW 17 84670220 critical splice donor site probably null
R3121:Abcg5 UTSW 17 84658663 missense probably benign 0.33
R4694:Abcg5 UTSW 17 84672158 missense probably damaging 1.00
R4835:Abcg5 UTSW 17 84658648 missense possibly damaging 0.95
R5187:Abcg5 UTSW 17 84658564 missense probably damaging 1.00
R5348:Abcg5 UTSW 17 84671206 missense possibly damaging 0.92
R5445:Abcg5 UTSW 17 84671129 missense probably damaging 1.00
R5580:Abcg5 UTSW 17 84660154 missense probably damaging 1.00
R5807:Abcg5 UTSW 17 84672291 missense probably damaging 0.99
R6007:Abcg5 UTSW 17 84668964 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGAGAAAATGGTGGGTTTTCAG -3'
(R):5'- ACAGTAAGGATCACTTTTACCATAGA -3'

Sequencing Primer
(F):5'- GAGCTCTTGACTCTAGCTGCATAAG -3'
(R):5'- CCTAGAACCTATTGAATTTTCTT -3'
Posted On2016-04-27