Incidental Mutation 'R0345:Zyg11b'
ID38377
Institutional Source Beutler Lab
Gene Symbol Zyg11b
Ensembl Gene ENSMUSG00000034636
Gene Namezyg-ll family member B, cell cycle regulator
Synonyms1110046I03Rik, LOC242610, 2810482G21Rik, D4Mgi23
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R0345 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108229724-108301096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108266407 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 121 (I121T)
Ref Sequence ENSEMBL: ENSMUSP00000043844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043616]
Predicted Effect probably damaging
Transcript: ENSMUST00000043616
AA Change: I121T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043844
Gene: ENSMUSG00000034636
AA Change: I121T

DomainStartEndE-ValueType
SCOP:d1jdha_ 370 722 3e-16 SMART
Blast:ARM 480 526 1e-17 BLAST
Blast:ARM 528 570 3e-19 BLAST
Blast:ARM 638 679 3e-10 BLAST
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Adgrb1 A G 15: 74,543,349 N641S probably damaging Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Ap2a2 T A 7: 141,631,293 M914K probably damaging Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Chrnb4 A G 9: 55,035,594 V132A probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Cyp2d37-ps A T 15: 82,689,774 noncoding transcript Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Llgl2 A G 11: 115,849,992 probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myo5c A G 9: 75,297,419 E1518G probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr670 T A 7: 104,960,181 M184L probably damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Olfr992 T C 2: 85,400,341 Q64R possibly damaging Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sntb2 T C 8: 107,001,538 S373P probably damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stap2 A G 17: 56,000,097 V217A probably damaging Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Synm C T 7: 67,735,821 V256I probably benign Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Other mutations in Zyg11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Zyg11b APN 4 108237416 missense probably damaging 1.00
IGL01143:Zyg11b APN 4 108244994 missense possibly damaging 0.69
IGL01627:Zyg11b APN 4 108250788 missense probably benign 0.19
IGL02517:Zyg11b APN 4 108266318 missense probably damaging 0.96
IGL03166:Zyg11b APN 4 108265889 missense probably benign 0.32
R0326:Zyg11b UTSW 4 108272253 missense possibly damaging 0.77
R0396:Zyg11b UTSW 4 108255308 missense probably damaging 1.00
R0571:Zyg11b UTSW 4 108260042 missense probably damaging 1.00
R0718:Zyg11b UTSW 4 108242076 missense possibly damaging 0.94
R1426:Zyg11b UTSW 4 108250812 missense probably damaging 1.00
R1495:Zyg11b UTSW 4 108266213 missense probably damaging 1.00
R1829:Zyg11b UTSW 4 108266093 missense possibly damaging 0.65
R1907:Zyg11b UTSW 4 108255226 missense probably damaging 1.00
R1916:Zyg11b UTSW 4 108272283 missense probably damaging 0.99
R1980:Zyg11b UTSW 4 108265930 missense probably damaging 0.99
R2070:Zyg11b UTSW 4 108250819 missense possibly damaging 0.73
R2495:Zyg11b UTSW 4 108244724 critical splice donor site probably null
R4717:Zyg11b UTSW 4 108241872 missense probably damaging 0.99
R5889:Zyg11b UTSW 4 108237380 nonsense probably null
R5957:Zyg11b UTSW 4 108245013 missense probably damaging 1.00
R6606:Zyg11b UTSW 4 108236089 missense probably benign 0.00
R7151:Zyg11b UTSW 4 108244922 missense not run
X0022:Zyg11b UTSW 4 108236101 missense probably benign
X0067:Zyg11b UTSW 4 108255346 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGCAGCGAAGCAACTTCAGC -3'
(R):5'- AGTGAATCTCCGCAATGTCTGTTCC -3'

Sequencing Primer
(F):5'- CAGCCAGATCTTCATTGTAAAAGAGC -3'
(R):5'- GCTCCATAATCTTGGAAAGTTCTC -3'
Posted On2013-05-23