Incidental Mutation 'R0345:Synm'
ID38388
Institutional Source Beutler Lab
Gene Symbol Synm
Ensembl Gene ENSMUSG00000030554
Gene Namesynemin, intermediate filament protein
Synonyms4930412K21Rik, Dmn, Synemin
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R0345 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location67730160-67759742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67735821 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 256 (V256I)
Ref Sequence ENSEMBL: ENSMUSP00000146510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051389] [ENSMUST00000074233] [ENSMUST00000207102] [ENSMUST00000208231] [ENSMUST00000208815]
Predicted Effect probably benign
Transcript: ENSMUST00000051389
AA Change: V698I

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000050987
Gene: ENSMUSG00000030554
AA Change: V698I

DomainStartEndE-ValueType
Pfam:Filament 10 321 2.7e-38 PFAM
low complexity region 1248 1257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074233
AA Change: V698I

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000073855
Gene: ENSMUSG00000030554
AA Change: V698I

DomainStartEndE-ValueType
Filament 10 321 6.4e-38 SMART
internal_repeat_1 1089 1185 3.03e-7 PROSPERO
internal_repeat_1 1351 1454 3.03e-7 PROSPERO
low complexity region 1550 1559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207102
AA Change: V256I

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000208231
Predicted Effect probably benign
Transcript: ENSMUST00000208764
Predicted Effect probably benign
Transcript: ENSMUST00000208815
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intermediate filament (IF) family member. IF proteins are cytoskeletal proteins that confer resistance to mechanical stress and are encoded by a dispersed multigene family. This protein has been found to form a linkage between desmin, which is a subunit of the IF network, and the extracellular matrix, and provides an important structural support in muscle. Two alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a mild skeletal muscle phenotype characterized by abnormal muscle fiber morphology and increased sarcolemmal deformability and susceptibility to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Adgrb1 A G 15: 74,543,349 N641S probably damaging Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Ap2a2 T A 7: 141,631,293 M914K probably damaging Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Chrnb4 A G 9: 55,035,594 V132A probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Cyp2d37-ps A T 15: 82,689,774 noncoding transcript Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Llgl2 A G 11: 115,849,992 probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myo5c A G 9: 75,297,419 E1518G probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr670 T A 7: 104,960,181 M184L probably damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Olfr992 T C 2: 85,400,341 Q64R possibly damaging Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sntb2 T C 8: 107,001,538 S373P probably damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stap2 A G 17: 56,000,097 V217A probably damaging Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Zyg11b A G 4: 108,266,407 I121T probably damaging Het
Other mutations in Synm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Synm APN 7 67734915 missense probably benign 0.01
IGL01567:Synm APN 7 67735232 missense probably damaging 0.99
IGL01867:Synm APN 7 67733474 missense probably benign 0.13
IGL01870:Synm APN 7 67736118 missense possibly damaging 0.86
IGL01951:Synm APN 7 67739137 missense probably damaging 1.00
IGL02264:Synm APN 7 67734396 missense probably damaging 0.99
IGL02892:Synm APN 7 67735056 missense probably damaging 1.00
R0032:Synm UTSW 7 67733927 missense possibly damaging 0.90
R0194:Synm UTSW 7 67734924 missense probably damaging 1.00
R0453:Synm UTSW 7 67736882 missense possibly damaging 0.92
R0646:Synm UTSW 7 67759168 missense probably benign 0.07
R0847:Synm UTSW 7 67735056 missense probably damaging 1.00
R0919:Synm UTSW 7 67735347 missense probably damaging 1.00
R1484:Synm UTSW 7 67736332 missense probably damaging 1.00
R1700:Synm UTSW 7 67759628 start codon destroyed probably null 0.98
R1715:Synm UTSW 7 67736303 missense probably damaging 1.00
R1796:Synm UTSW 7 67734000 missense possibly damaging 0.77
R1799:Synm UTSW 7 67735959 missense probably damaging 1.00
R2116:Synm UTSW 7 67733595 missense probably benign 0.18
R2979:Synm UTSW 7 67736260 missense probably damaging 1.00
R4116:Synm UTSW 7 67734657 missense possibly damaging 0.50
R4172:Synm UTSW 7 67735361 missense probably damaging 1.00
R4981:Synm UTSW 7 67734487 missense probably benign 0.02
R5114:Synm UTSW 7 67735658 missense probably damaging 1.00
R5276:Synm UTSW 7 67734689 missense probably benign 0.08
R5446:Synm UTSW 7 67735974 missense probably benign 0.17
R5592:Synm UTSW 7 67759516 missense probably damaging 1.00
R5960:Synm UTSW 7 67735746 missense probably damaging 1.00
R6025:Synm UTSW 7 67734938 missense possibly damaging 0.78
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6445:Synm UTSW 7 67733645 missense probably benign
R6446:Synm UTSW 7 67734966 missense probably damaging 1.00
R6492:Synm UTSW 7 67736061 missense probably benign 0.00
R6526:Synm UTSW 7 67735583 missense possibly damaging 0.62
R6612:Synm UTSW 7 67733516 missense probably damaging 0.99
R6646:Synm UTSW 7 67735127 missense probably damaging 1.00
R6708:Synm UTSW 7 67733246 missense possibly damaging 0.72
R6957:Synm UTSW 7 67736100 missense probably benign 0.28
R6988:Synm UTSW 7 67733658 missense probably damaging 1.00
Z1088:Synm UTSW 7 67751886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCTGCCCATACACTGAGCCATC -3'
(R):5'- GCTCTCTGCAAAGTGACTCAACGAC -3'

Sequencing Primer
(F):5'- GTACTCATCTGGGGTAGACAC -3'
(R):5'- AGAAACCATAGCCGAAAGCATTG -3'
Posted On2013-05-23