Incidental Mutation 'R0345:Olfr670'
ID38390
Institutional Source Beutler Lab
Gene Symbol Olfr670
Ensembl Gene ENSMUSG00000044705
Gene Nameolfactory receptor 670
SynonymsMOR32-8, GA_x6K02T2PBJ9-7589577-7588639
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0345 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104957114-104962620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104960181 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 184 (M184L)
Ref Sequence ENSEMBL: ENSMUSP00000151138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050482] [ENSMUST00000214216]
Predicted Effect probably damaging
Transcript: ENSMUST00000050482
AA Change: M184L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060289
Gene: ENSMUSG00000044705
AA Change: M184L

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 3.7e-121 PFAM
Pfam:7TM_GPCR_Srsx 37 211 4.5e-7 PFAM
Pfam:7tm_1 43 293 3.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214216
AA Change: M184L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Adgrb1 A G 15: 74,543,349 N641S probably damaging Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Ap2a2 T A 7: 141,631,293 M914K probably damaging Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Chrnb4 A G 9: 55,035,594 V132A probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Cyp2d37-ps A T 15: 82,689,774 noncoding transcript Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Llgl2 A G 11: 115,849,992 probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myo5c A G 9: 75,297,419 E1518G probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Olfr992 T C 2: 85,400,341 Q64R possibly damaging Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sntb2 T C 8: 107,001,538 S373P probably damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stap2 A G 17: 56,000,097 V217A probably damaging Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Synm C T 7: 67,735,821 V256I probably benign Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Zyg11b A G 4: 108,266,407 I121T probably damaging Het
Other mutations in Olfr670
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Olfr670 APN 7 104960716 missense probably damaging 0.96
IGL01100:Olfr670 APN 7 104959995 missense probably benign 0.07
IGL01351:Olfr670 APN 7 104960739 start gained probably benign
IGL01478:Olfr670 APN 7 104960348 missense probably damaging 0.97
IGL01835:Olfr670 APN 7 104960462 missense probably benign 0.01
IGL02326:Olfr670 APN 7 104960646 missense probably benign 0.12
IGL02434:Olfr670 APN 7 104960072 missense probably benign 0.05
IGL02434:Olfr670 APN 7 104960074 nonsense probably null
IGL02968:Olfr670 APN 7 104960244 missense possibly damaging 0.90
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0401:Olfr670 UTSW 7 104959943 missense probably damaging 1.00
R0646:Olfr670 UTSW 7 104959811 missense probably benign 0.02
R1493:Olfr670 UTSW 7 104960502 missense probably damaging 0.97
R1532:Olfr670 UTSW 7 104960265 missense probably benign
R1557:Olfr670 UTSW 7 104960540 missense probably damaging 0.99
R4072:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4074:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4075:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4076:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4229:Olfr670 UTSW 7 104960594 missense probably benign 0.18
R4230:Olfr670 UTSW 7 104960594 missense probably benign 0.18
R5374:Olfr670 UTSW 7 104959996 missense probably damaging 1.00
R6006:Olfr670 UTSW 7 104960663 missense probably damaging 0.99
R6891:Olfr670 UTSW 7 104959985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGATCCCGAATCTGCTTAGTCC -3'
(R):5'- TGACCGCTATGTTGCCATCTGC -3'

Sequencing Primer
(F):5'- GCCAAACCTATGTGTCATGAATGAG -3'
(R):5'- CAATCCTCTGCGGTACAGTCAG -3'
Posted On2013-05-23