Incidental Mutation 'R4965:2810474O19Rik'
ID383903
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4965 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 149328398 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 981 (G981*)
Ref Sequence ENSEMBL: ENSMUSP00000139624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect probably null
Transcript: ENSMUST00000046689
AA Change: G981*
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: G981*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100765
AA Change: G981*
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: G981*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably benign
Transcript: ENSMUST00000130664
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect probably null
Transcript: ENSMUST00000189837
AA Change: G981*
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: G981*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189932
AA Change: G981*
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: G981*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190785
AA Change: G981*
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712
AA Change: G981*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,672 T1541A probably benign Het
4931423N10Rik C A 2: 23,245,115 T312K probably benign Het
9530002B09Rik T C 4: 122,700,492 M59T probably benign Het
Adam18 C T 8: 24,641,811 C428Y probably damaging Het
Adcy5 A G 16: 35,278,502 E700G possibly damaging Het
Adprh G T 16: 38,445,780 Y333* probably null Het
Agfg2 C A 5: 137,667,177 probably null Het
Akip1 A T 7: 109,711,754 E167V probably damaging Het
Akr1c21 A T 13: 4,580,305 Q199L probably damaging Het
Aldh9a1 C A 1: 167,365,789 A455E probably damaging Het
Amph G A 13: 19,137,699 S520N probably benign Het
Ankrd52 A G 10: 128,390,507 D1006G probably benign Het
Ap5z1 A C 5: 142,467,676 Q133P probably damaging Het
Babam1 C T 8: 71,404,388 A331V possibly damaging Het
Btc T C 5: 91,362,301 probably null Het
Cacna2d3 A G 14: 28,982,332 F831L probably benign Het
Cadm3 G A 1: 173,337,097 P372L probably damaging Het
Capn5 A T 7: 98,126,417 M439K probably damaging Het
Carf T C 1: 60,150,637 S639P probably damaging Het
Casp12 C T 9: 5,352,250 R81C probably benign Het
Ces2e G T 8: 104,933,698 R555M probably benign Het
Cfap54 T A 10: 93,066,799 I164F probably benign Het
Cltc C T 11: 86,707,501 V1012I probably damaging Het
Cmya5 G A 13: 93,095,787 T931I possibly damaging Het
Cntn6 A G 6: 104,774,474 I364V probably damaging Het
Cntnap1 A T 11: 101,177,425 I59F possibly damaging Het
Cop1 T C 1: 159,239,597 M80T probably damaging Het
Cplx2 A G 13: 54,379,647 S115G possibly damaging Het
Crtac1 A G 19: 42,318,740 Y195H probably damaging Het
Csn1s2a A C 5: 87,781,838 S99R possibly damaging Het
Csn1s2b T A 5: 87,813,961 D41E possibly damaging Het
Cul9 C T 17: 46,538,525 D565N probably damaging Het
Cux1 A T 5: 136,311,556 N625K possibly damaging Het
Cyp2c37 A T 19: 40,011,762 M443L possibly damaging Het
Cyp2s1 G A 7: 25,809,285 T244I possibly damaging Het
Dgkh C T 14: 78,624,421 V135M probably damaging Het
Dtl T C 1: 191,546,565 E395G possibly damaging Het
Dyrk1a G T 16: 94,691,995 G658* probably null Het
Erlin2 T C 8: 27,029,595 F117S probably damaging Het
Fkbp8 A G 8: 70,531,523 probably null Het
Fras1 T C 5: 96,726,580 F2288S possibly damaging Het
Frmd3 A G 4: 74,153,600 T240A probably damaging Het
H2-D1 A G 17: 35,263,905 Y137C probably damaging Het
Helz2 A G 2: 181,240,916 V28A possibly damaging Het
Hydin A G 8: 110,398,095 I579V probably benign Het
Il6 A T 5: 30,013,493 Y29F possibly damaging Het
Ildr2 A G 1: 166,307,840 D368G probably damaging Het
Junb T A 8: 84,978,159 I91F probably damaging Het
Kat2a C A 11: 100,712,203 probably benign Het
Kat2a A T 11: 100,712,204 probably benign Het
Kcnh5 T A 12: 74,965,151 T665S probably benign Het
Kdm1b A T 13: 47,074,367 D608V probably damaging Het
Krcc1 A G 6: 71,284,637 K218E probably damaging Het
Krt8 C T 15: 101,996,951 V488M probably benign Het
Lzts1 C T 8: 69,138,762 A245T probably benign Het
Mcm6 T A 1: 128,359,486 Q27L probably damaging Het
Mfsd4b3 G T 10: 39,947,690 Y191* probably null Het
Mgme1 C T 2: 144,276,404 Q199* probably null Het
Mgme1 T C 2: 144,279,620 L332P probably benign Het
Morc3 G T 16: 93,860,587 E25* probably null Het
Mroh7 G A 4: 106,690,987 A1098V possibly damaging Het
Mtrf1 G A 14: 79,406,587 R174H probably benign Het
Mybpc3 G A 2: 91,119,247 G45D possibly damaging Het
Mycbpap A T 11: 94,504,938 N733K probably damaging Het
N4bp1 T C 8: 86,851,686 I684V possibly damaging Het
Nav2 A T 7: 49,552,877 R1470* probably null Het
Ndufa9 A T 6: 126,822,063 S364T probably benign Het
Nipal4 C A 11: 46,162,010 A43S possibly damaging Het
Nlrp1a T A 11: 71,092,315 Y1275F possibly damaging Het
Nova1 A T 12: 46,720,835 L8* probably null Het
Odam G T 5: 87,890,108 G181* probably null Het
Olfr1111 T A 2: 87,150,659 M1L possibly damaging Het
Olfr1297 T C 2: 111,621,534 D180G probably damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Olfr186 A T 16: 59,027,333 D191E probably damaging Het
Olfr283 T C 15: 98,379,149 probably benign Het
Olfr33 A T 7: 102,713,495 I306N probably damaging Het
Olfr723 C T 14: 49,928,897 V216I probably benign Het
Optn T A 2: 5,021,379 Q576L probably benign Het
Patl2 G T 2: 122,128,848 S45* probably null Het
Pde2a G A 7: 101,502,933 G349E probably benign Het
Pdlim2 T A 14: 70,168,015 probably benign Het
Per1 T C 11: 69,104,401 V653A probably benign Het
Phlda2 A G 7: 143,502,268 S75P probably damaging Het
Poldip3 A T 15: 83,137,505 M167K possibly damaging Het
Prpf38a T C 4: 108,579,081 I12V probably benign Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Ptges3l A T 11: 101,424,622 M1K probably null Het
Rdh5 A G 10: 128,913,784 Y296H probably damaging Het
Rnf2 T A 1: 151,473,217 K51* probably null Het
Rpusd3 C A 6: 113,416,848 R215L probably benign Het
Rsph4a A T 10: 33,909,240 E382D probably damaging Het
S1pr2 G A 9: 20,968,449 Q28* probably null Het
Sesn1 A T 10: 41,895,009 I179F probably damaging Het
Setd3 T A 12: 108,113,371 E291V probably benign Het
Shc1 G T 3: 89,426,996 R323L probably damaging Het
Slc22a5 T C 11: 53,891,526 D5G possibly damaging Het
Slc6a19 T C 13: 73,700,558 K26E probably benign Het
Slc9a3 A G 13: 74,164,293 N670D possibly damaging Het
Spata19 A T 9: 27,400,465 I127L probably benign Het
Speg G T 1: 75,427,703 V2751L probably damaging Het
Sptbn2 A G 19: 4,729,309 D298G probably benign Het
Srm T C 4: 148,594,183 V289A possibly damaging Het
Stip1 C T 19: 7,035,570 A49T probably benign Het
Tas2r118 C A 6: 23,969,628 V145F probably benign Het
Tbc1d12 A T 19: 38,865,725 K284* probably null Het
Tfcp2 T C 15: 100,525,650 H125R probably damaging Het
Tfdp1 T C 8: 13,373,073 V206A probably damaging Het
Tgtp2 A G 11: 49,059,410 W112R probably damaging Het
Tmem71 T G 15: 66,538,861 M221L probably benign Het
Tpcn1 T C 5: 120,547,487 N436S possibly damaging Het
Usp4 C T 9: 108,362,620 L183F probably damaging Het
Vmn2r55 A T 7: 12,670,551 N308K possibly damaging Het
Zfp106 T A 2: 120,533,919 D669V probably damaging Het
Zfp108 A T 7: 24,260,148 I55L probably benign Het
Zfp512b A T 2: 181,586,338 S8R probably damaging Het
Zfp827 T C 8: 79,061,281 S359P probably benign Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTTGGAATGTTGGATCCAGAG -3'
(R):5'- CATTTTCAGTGAGGTATCATGCC -3'

Sequencing Primer
(F):5'- GAAAGACAAAATCCATTGCTGTGC -3'
(R):5'- TTTCACCATGCACTGCAG -3'
Posted On2016-04-27