Incidental Mutation 'R4965:Nav2'
ID383908
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Nameneuron navigator 2
SynonymsRainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.686) question?
Stock #R4965 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48908716-49610090 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 49552877 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1470 (R1470*)
Ref Sequence ENSEMBL: ENSMUSP00000139045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184109] [ENSMUST00000184945]
Predicted Effect probably null
Transcript: ENSMUST00000064395
AA Change: R1470*
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: R1470*

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183659
AA Change: R1409*
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: R1409*

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184109
SMART Domains Protein: ENSMUSP00000138846
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
low complexity region 154 171 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184544
Predicted Effect probably null
Transcript: ENSMUST00000184945
AA Change: R1470*
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: R1470*

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,672 T1541A probably benign Het
2810474O19Rik G T 6: 149,328,398 G981* probably null Het
4931423N10Rik C A 2: 23,245,115 T312K probably benign Het
9530002B09Rik T C 4: 122,700,492 M59T probably benign Het
Adam18 C T 8: 24,641,811 C428Y probably damaging Het
Adcy5 A G 16: 35,278,502 E700G possibly damaging Het
Adprh G T 16: 38,445,780 Y333* probably null Het
Agfg2 C A 5: 137,667,177 probably null Het
Akip1 A T 7: 109,711,754 E167V probably damaging Het
Akr1c21 A T 13: 4,580,305 Q199L probably damaging Het
Aldh9a1 C A 1: 167,365,789 A455E probably damaging Het
Amph G A 13: 19,137,699 S520N probably benign Het
Ankrd52 A G 10: 128,390,507 D1006G probably benign Het
Ap5z1 A C 5: 142,467,676 Q133P probably damaging Het
Babam1 C T 8: 71,404,388 A331V possibly damaging Het
Btc T C 5: 91,362,301 probably null Het
Cacna2d3 A G 14: 28,982,332 F831L probably benign Het
Cadm3 G A 1: 173,337,097 P372L probably damaging Het
Capn5 A T 7: 98,126,417 M439K probably damaging Het
Carf T C 1: 60,150,637 S639P probably damaging Het
Casp12 C T 9: 5,352,250 R81C probably benign Het
Ces2e G T 8: 104,933,698 R555M probably benign Het
Cfap54 T A 10: 93,066,799 I164F probably benign Het
Cltc C T 11: 86,707,501 V1012I probably damaging Het
Cmya5 G A 13: 93,095,787 T931I possibly damaging Het
Cntn6 A G 6: 104,774,474 I364V probably damaging Het
Cntnap1 A T 11: 101,177,425 I59F possibly damaging Het
Cop1 T C 1: 159,239,597 M80T probably damaging Het
Cplx2 A G 13: 54,379,647 S115G possibly damaging Het
Crtac1 A G 19: 42,318,740 Y195H probably damaging Het
Csn1s2a A C 5: 87,781,838 S99R possibly damaging Het
Csn1s2b T A 5: 87,813,961 D41E possibly damaging Het
Cul9 C T 17: 46,538,525 D565N probably damaging Het
Cux1 A T 5: 136,311,556 N625K possibly damaging Het
Cyp2c37 A T 19: 40,011,762 M443L possibly damaging Het
Cyp2s1 G A 7: 25,809,285 T244I possibly damaging Het
Dgkh C T 14: 78,624,421 V135M probably damaging Het
Dtl T C 1: 191,546,565 E395G possibly damaging Het
Dyrk1a G T 16: 94,691,995 G658* probably null Het
Erlin2 T C 8: 27,029,595 F117S probably damaging Het
Fkbp8 A G 8: 70,531,523 probably null Het
Fras1 T C 5: 96,726,580 F2288S possibly damaging Het
Frmd3 A G 4: 74,153,600 T240A probably damaging Het
H2-D1 A G 17: 35,263,905 Y137C probably damaging Het
Helz2 A G 2: 181,240,916 V28A possibly damaging Het
Hydin A G 8: 110,398,095 I579V probably benign Het
Il6 A T 5: 30,013,493 Y29F possibly damaging Het
Ildr2 A G 1: 166,307,840 D368G probably damaging Het
Junb T A 8: 84,978,159 I91F probably damaging Het
Kat2a C A 11: 100,712,203 probably benign Het
Kat2a A T 11: 100,712,204 probably benign Het
Kcnh5 T A 12: 74,965,151 T665S probably benign Het
Kdm1b A T 13: 47,074,367 D608V probably damaging Het
Krcc1 A G 6: 71,284,637 K218E probably damaging Het
Krt8 C T 15: 101,996,951 V488M probably benign Het
Lzts1 C T 8: 69,138,762 A245T probably benign Het
Mcm6 T A 1: 128,359,486 Q27L probably damaging Het
Mfsd4b3 G T 10: 39,947,690 Y191* probably null Het
Mgme1 C T 2: 144,276,404 Q199* probably null Het
Mgme1 T C 2: 144,279,620 L332P probably benign Het
Morc3 G T 16: 93,860,587 E25* probably null Het
Mroh7 G A 4: 106,690,987 A1098V possibly damaging Het
Mtrf1 G A 14: 79,406,587 R174H probably benign Het
Mybpc3 G A 2: 91,119,247 G45D possibly damaging Het
Mycbpap A T 11: 94,504,938 N733K probably damaging Het
N4bp1 T C 8: 86,851,686 I684V possibly damaging Het
Ndufa9 A T 6: 126,822,063 S364T probably benign Het
Nipal4 C A 11: 46,162,010 A43S possibly damaging Het
Nlrp1a T A 11: 71,092,315 Y1275F possibly damaging Het
Nova1 A T 12: 46,720,835 L8* probably null Het
Odam G T 5: 87,890,108 G181* probably null Het
Olfr1111 T A 2: 87,150,659 M1L possibly damaging Het
Olfr1297 T C 2: 111,621,534 D180G probably damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Olfr186 A T 16: 59,027,333 D191E probably damaging Het
Olfr283 T C 15: 98,379,149 probably benign Het
Olfr33 A T 7: 102,713,495 I306N probably damaging Het
Olfr723 C T 14: 49,928,897 V216I probably benign Het
Optn T A 2: 5,021,379 Q576L probably benign Het
Patl2 G T 2: 122,128,848 S45* probably null Het
Pde2a G A 7: 101,502,933 G349E probably benign Het
Pdlim2 T A 14: 70,168,015 probably benign Het
Per1 T C 11: 69,104,401 V653A probably benign Het
Phlda2 A G 7: 143,502,268 S75P probably damaging Het
Poldip3 A T 15: 83,137,505 M167K possibly damaging Het
Prpf38a T C 4: 108,579,081 I12V probably benign Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Ptges3l A T 11: 101,424,622 M1K probably null Het
Rdh5 A G 10: 128,913,784 Y296H probably damaging Het
Rnf2 T A 1: 151,473,217 K51* probably null Het
Rpusd3 C A 6: 113,416,848 R215L probably benign Het
Rsph4a A T 10: 33,909,240 E382D probably damaging Het
S1pr2 G A 9: 20,968,449 Q28* probably null Het
Sesn1 A T 10: 41,895,009 I179F probably damaging Het
Setd3 T A 12: 108,113,371 E291V probably benign Het
Shc1 G T 3: 89,426,996 R323L probably damaging Het
Slc22a5 T C 11: 53,891,526 D5G possibly damaging Het
Slc6a19 T C 13: 73,700,558 K26E probably benign Het
Slc9a3 A G 13: 74,164,293 N670D possibly damaging Het
Spata19 A T 9: 27,400,465 I127L probably benign Het
Speg G T 1: 75,427,703 V2751L probably damaging Het
Sptbn2 A G 19: 4,729,309 D298G probably benign Het
Srm T C 4: 148,594,183 V289A possibly damaging Het
Stip1 C T 19: 7,035,570 A49T probably benign Het
Tas2r118 C A 6: 23,969,628 V145F probably benign Het
Tbc1d12 A T 19: 38,865,725 K284* probably null Het
Tfcp2 T C 15: 100,525,650 H125R probably damaging Het
Tfdp1 T C 8: 13,373,073 V206A probably damaging Het
Tgtp2 A G 11: 49,059,410 W112R probably damaging Het
Tmem71 T G 15: 66,538,861 M221L probably benign Het
Tpcn1 T C 5: 120,547,487 N436S possibly damaging Het
Usp4 C T 9: 108,362,620 L183F probably damaging Het
Vmn2r55 A T 7: 12,670,551 N308K possibly damaging Het
Zfp106 T A 2: 120,533,919 D669V probably damaging Het
Zfp108 A T 7: 24,260,148 I55L probably benign Het
Zfp512b A T 2: 181,586,338 S8R probably damaging Het
Zfp827 T C 8: 79,061,281 S359P probably benign Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49571194 missense probably damaging 1.00
IGL01150:Nav2 APN 7 49452521 missense probably benign 0.17
IGL01649:Nav2 APN 7 49575729 missense probably damaging 1.00
IGL01662:Nav2 APN 7 49571209 missense probably damaging 1.00
IGL02297:Nav2 APN 7 49594229 missense probably damaging 0.98
IGL02313:Nav2 APN 7 49558773 missense probably damaging 0.99
IGL02441:Nav2 APN 7 49452512 missense probably damaging 1.00
IGL02472:Nav2 APN 7 49546041 missense probably damaging 1.00
IGL02477:Nav2 APN 7 49582875 missense probably damaging 0.99
IGL02725:Nav2 APN 7 49565095 missense probably damaging 1.00
IGL02944:Nav2 APN 7 49420256 missense probably damaging 0.99
IGL02953:Nav2 APN 7 49548423 missense probably damaging 1.00
IGL03105:Nav2 APN 7 49464879 missense probably damaging 1.00
IGL03234:Nav2 APN 7 49462008 missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49362099 missense probably damaging 1.00
IGL03294:Nav2 APN 7 49491457 nonsense probably null
R0006:Nav2 UTSW 7 49453230 missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49570714 missense probably damaging 1.00
R0113:Nav2 UTSW 7 49535953 missense probably damaging 1.00
R0306:Nav2 UTSW 7 49545903 missense probably benign 0.01
R0346:Nav2 UTSW 7 49604585 missense probably benign 0.11
R0539:Nav2 UTSW 7 49461938 missense probably damaging 1.00
R0669:Nav2 UTSW 7 49408683 missense probably damaging 1.00
R0785:Nav2 UTSW 7 49420333 missense probably benign 0.06
R0970:Nav2 UTSW 7 49584153 missense probably damaging 1.00
R1162:Nav2 UTSW 7 49536040 splice site probably benign
R1274:Nav2 UTSW 7 49604430 nonsense probably null
R1463:Nav2 UTSW 7 49535962 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1536:Nav2 UTSW 7 49545934 missense probably damaging 1.00
R1612:Nav2 UTSW 7 49571211 missense probably damaging 1.00
R1638:Nav2 UTSW 7 49452465 missense probably benign
R1731:Nav2 UTSW 7 49548174 missense probably damaging 1.00
R1734:Nav2 UTSW 7 49575720 missense probably damaging 1.00
R1865:Nav2 UTSW 7 49548195 missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49464872 missense probably damaging 1.00
R1997:Nav2 UTSW 7 49548471 missense probably benign 0.16
R2061:Nav2 UTSW 7 49598897 splice site probably benign
R2117:Nav2 UTSW 7 49464580 missense probably benign 0.00
R2174:Nav2 UTSW 7 49452663 missense probably damaging 0.99
R2182:Nav2 UTSW 7 49597254 missense probably benign 0.38
R2251:Nav2 UTSW 7 49453277 missense probably damaging 1.00
R2283:Nav2 UTSW 7 49491404 missense probably damaging 1.00
R2343:Nav2 UTSW 7 49598817 missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49408884 missense probably benign
R2568:Nav2 UTSW 7 49597564 missense probably damaging 1.00
R2656:Nav2 UTSW 7 49545942 missense probably damaging 1.00
R2964:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R2966:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R3817:Nav2 UTSW 7 49464562 missense probably benign 0.00
R3834:Nav2 UTSW 7 49545858 missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49572298 splice site probably null
R4207:Nav2 UTSW 7 49597231 missense probably damaging 1.00
R4411:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4413:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4440:Nav2 UTSW 7 49552037 missense possibly damaging 0.86
R4440:Nav2 UTSW 7 49575263 splice site probably benign
R4454:Nav2 UTSW 7 49548544 splice site probably null
R4729:Nav2 UTSW 7 49452819 missense probably benign 0.17
R4801:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49409001 intron probably benign
R4887:Nav2 UTSW 7 49548434 nonsense probably null
R4908:Nav2 UTSW 7 49604510 missense probably damaging 1.00
R4952:Nav2 UTSW 7 49304540 intron probably benign
R5169:Nav2 UTSW 7 49548483 nonsense probably null
R5224:Nav2 UTSW 7 49551725 missense probably benign 0.00
R5249:Nav2 UTSW 7 49535913 missense probably damaging 1.00
R5285:Nav2 UTSW 7 49548234 missense probably damaging 1.00
R5314:Nav2 UTSW 7 49408692 small deletion probably benign
R5320:Nav2 UTSW 7 49491373 missense probably benign 0.00
R5377:Nav2 UTSW 7 49589160 missense probably benign 0.02
R5471:Nav2 UTSW 7 49548169 missense probably damaging 1.00
R5754:Nav2 UTSW 7 49557046 missense probably damaging 1.00
R5832:Nav2 UTSW 7 49548069 unclassified probably null
R5884:Nav2 UTSW 7 49597169 nonsense probably null
R5921:Nav2 UTSW 7 49304576 intron probably benign
R6180:Nav2 UTSW 7 49458167 missense probably benign 0.39
R6208:Nav2 UTSW 7 49564103 missense probably damaging 0.99
R6373:Nav2 UTSW 7 49453175 missense probably damaging 1.00
R6450:Nav2 UTSW 7 49594366 missense probably damaging 1.00
R6522:Nav2 UTSW 7 49597533 missense probably damaging 1.00
R6626:Nav2 UTSW 7 49594352 missense probably damaging 1.00
R6695:Nav2 UTSW 7 49464904 missense probably benign 0.04
R6705:Nav2 UTSW 7 49551916 missense probably damaging 1.00
R6842:Nav2 UTSW 7 49458169 missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49491456 missense probably benign 0.14
X0023:Nav2 UTSW 7 49547899 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCAGTCTGCTACAGTCTTGGG -3'
(R):5'- TTTAGCAGACAGTGGAGCAG -3'

Sequencing Primer
(F):5'- CTGCTACAGTCTTGGGGTGTGTC -3'
(R):5'- AGCAGGTCCTCACTGGCATG -3'
Posted On2016-04-27