Incidental Mutation 'R4965:Hydin'
ID383924
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene NameHYDIN, axonemal central pair apparatus protein
Synonymshy-3, hyrh, hy3, 1700034M11Rik, 4930545D19Rik
Accession Numbers

Ncbi RefSeq: NM_172916; MGI: 2389007

Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R4965 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110266977-110610253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110398095 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 579 (I579V)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
Predicted Effect probably benign
Transcript: ENSMUST00000043141
AA Change: I579V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: I579V

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212218
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype Strain: 1856913; 3801608
Lethality: D28-D42
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,672 T1541A probably benign Het
2810474O19Rik G T 6: 149,328,398 G981* probably null Het
4931423N10Rik C A 2: 23,245,115 T312K probably benign Het
9530002B09Rik T C 4: 122,700,492 M59T probably benign Het
Adam18 C T 8: 24,641,811 C428Y probably damaging Het
Adcy5 A G 16: 35,278,502 E700G possibly damaging Het
Adprh G T 16: 38,445,780 Y333* probably null Het
Agfg2 C A 5: 137,667,177 probably null Het
Akip1 A T 7: 109,711,754 E167V probably damaging Het
Akr1c21 A T 13: 4,580,305 Q199L probably damaging Het
Aldh9a1 C A 1: 167,365,789 A455E probably damaging Het
Amph G A 13: 19,137,699 S520N probably benign Het
Ankrd52 A G 10: 128,390,507 D1006G probably benign Het
Ap5z1 A C 5: 142,467,676 Q133P probably damaging Het
Babam1 C T 8: 71,404,388 A331V possibly damaging Het
Btc T C 5: 91,362,301 probably null Het
Cacna2d3 A G 14: 28,982,332 F831L probably benign Het
Cadm3 G A 1: 173,337,097 P372L probably damaging Het
Capn5 A T 7: 98,126,417 M439K probably damaging Het
Carf T C 1: 60,150,637 S639P probably damaging Het
Casp12 C T 9: 5,352,250 R81C probably benign Het
Ces2e G T 8: 104,933,698 R555M probably benign Het
Cfap54 T A 10: 93,066,799 I164F probably benign Het
Cltc C T 11: 86,707,501 V1012I probably damaging Het
Cmya5 G A 13: 93,095,787 T931I possibly damaging Het
Cntn6 A G 6: 104,774,474 I364V probably damaging Het
Cntnap1 A T 11: 101,177,425 I59F possibly damaging Het
Cop1 T C 1: 159,239,597 M80T probably damaging Het
Cplx2 A G 13: 54,379,647 S115G possibly damaging Het
Crtac1 A G 19: 42,318,740 Y195H probably damaging Het
Csn1s2a A C 5: 87,781,838 S99R possibly damaging Het
Csn1s2b T A 5: 87,813,961 D41E possibly damaging Het
Cul9 C T 17: 46,538,525 D565N probably damaging Het
Cux1 A T 5: 136,311,556 N625K possibly damaging Het
Cyp2c37 A T 19: 40,011,762 M443L possibly damaging Het
Cyp2s1 G A 7: 25,809,285 T244I possibly damaging Het
Dgkh C T 14: 78,624,421 V135M probably damaging Het
Dtl T C 1: 191,546,565 E395G possibly damaging Het
Dyrk1a G T 16: 94,691,995 G658* probably null Het
Erlin2 T C 8: 27,029,595 F117S probably damaging Het
Fkbp8 A G 8: 70,531,523 probably null Het
Fras1 T C 5: 96,726,580 F2288S possibly damaging Het
Frmd3 A G 4: 74,153,600 T240A probably damaging Het
H2-D1 A G 17: 35,263,905 Y137C probably damaging Het
Helz2 A G 2: 181,240,916 V28A possibly damaging Het
Il6 A T 5: 30,013,493 Y29F possibly damaging Het
Ildr2 A G 1: 166,307,840 D368G probably damaging Het
Junb T A 8: 84,978,159 I91F probably damaging Het
Kat2a C A 11: 100,712,203 probably benign Het
Kat2a A T 11: 100,712,204 probably benign Het
Kcnh5 T A 12: 74,965,151 T665S probably benign Het
Kdm1b A T 13: 47,074,367 D608V probably damaging Het
Krcc1 A G 6: 71,284,637 K218E probably damaging Het
Krt8 C T 15: 101,996,951 V488M probably benign Het
Lzts1 C T 8: 69,138,762 A245T probably benign Het
Mcm6 T A 1: 128,359,486 Q27L probably damaging Het
Mfsd4b3 G T 10: 39,947,690 Y191* probably null Het
Mgme1 C T 2: 144,276,404 Q199* probably null Het
Mgme1 T C 2: 144,279,620 L332P probably benign Het
Morc3 G T 16: 93,860,587 E25* probably null Het
Mroh7 G A 4: 106,690,987 A1098V possibly damaging Het
Mtrf1 G A 14: 79,406,587 R174H probably benign Het
Mybpc3 G A 2: 91,119,247 G45D possibly damaging Het
Mycbpap A T 11: 94,504,938 N733K probably damaging Het
N4bp1 T C 8: 86,851,686 I684V possibly damaging Het
Nav2 A T 7: 49,552,877 R1470* probably null Het
Ndufa9 A T 6: 126,822,063 S364T probably benign Het
Nipal4 C A 11: 46,162,010 A43S possibly damaging Het
Nlrp1a T A 11: 71,092,315 Y1275F possibly damaging Het
Nova1 A T 12: 46,720,835 L8* probably null Het
Odam G T 5: 87,890,108 G181* probably null Het
Olfr1111 T A 2: 87,150,659 M1L possibly damaging Het
Olfr1297 T C 2: 111,621,534 D180G probably damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Olfr186 A T 16: 59,027,333 D191E probably damaging Het
Olfr283 T C 15: 98,379,149 probably benign Het
Olfr33 A T 7: 102,713,495 I306N probably damaging Het
Olfr723 C T 14: 49,928,897 V216I probably benign Het
Optn T A 2: 5,021,379 Q576L probably benign Het
Patl2 G T 2: 122,128,848 S45* probably null Het
Pde2a G A 7: 101,502,933 G349E probably benign Het
Pdlim2 T A 14: 70,168,015 probably benign Het
Per1 T C 11: 69,104,401 V653A probably benign Het
Phlda2 A G 7: 143,502,268 S75P probably damaging Het
Poldip3 A T 15: 83,137,505 M167K possibly damaging Het
Prpf38a T C 4: 108,579,081 I12V probably benign Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Ptges3l A T 11: 101,424,622 M1K probably null Het
Rdh5 A G 10: 128,913,784 Y296H probably damaging Het
Rnf2 T A 1: 151,473,217 K51* probably null Het
Rpusd3 C A 6: 113,416,848 R215L probably benign Het
Rsph4a A T 10: 33,909,240 E382D probably damaging Het
S1pr2 G A 9: 20,968,449 Q28* probably null Het
Sesn1 A T 10: 41,895,009 I179F probably damaging Het
Setd3 T A 12: 108,113,371 E291V probably benign Het
Shc1 G T 3: 89,426,996 R323L probably damaging Het
Slc22a5 T C 11: 53,891,526 D5G possibly damaging Het
Slc6a19 T C 13: 73,700,558 K26E probably benign Het
Slc9a3 A G 13: 74,164,293 N670D possibly damaging Het
Spata19 A T 9: 27,400,465 I127L probably benign Het
Speg G T 1: 75,427,703 V2751L probably damaging Het
Sptbn2 A G 19: 4,729,309 D298G probably benign Het
Srm T C 4: 148,594,183 V289A possibly damaging Het
Stip1 C T 19: 7,035,570 A49T probably benign Het
Tas2r118 C A 6: 23,969,628 V145F probably benign Het
Tbc1d12 A T 19: 38,865,725 K284* probably null Het
Tfcp2 T C 15: 100,525,650 H125R probably damaging Het
Tfdp1 T C 8: 13,373,073 V206A probably damaging Het
Tgtp2 A G 11: 49,059,410 W112R probably damaging Het
Tmem71 T G 15: 66,538,861 M221L probably benign Het
Tpcn1 T C 5: 120,547,487 N436S possibly damaging Het
Usp4 C T 9: 108,362,620 L183F probably damaging Het
Vmn2r55 A T 7: 12,670,551 N308K possibly damaging Het
Zfp106 T A 2: 120,533,919 D669V probably damaging Het
Zfp108 A T 7: 24,260,148 I55L probably benign Het
Zfp512b A T 2: 181,586,338 S8R probably damaging Het
Zfp827 T C 8: 79,061,281 S359P probably benign Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 110569802 missense possibly damaging 0.69
IGL00432:Hydin APN 8 110601252 missense probably damaging 0.98
IGL01025:Hydin APN 8 110326401 missense probably benign 0.38
IGL01140:Hydin APN 8 110398062 missense probably benign 0.14
IGL01317:Hydin APN 8 110326446 missense probably damaging 0.98
IGL01473:Hydin APN 8 110312160 missense probably benign 0.08
IGL01473:Hydin APN 8 110354953 missense probably damaging 1.00
IGL01610:Hydin APN 8 110557713 missense probably benign 0.00
IGL01685:Hydin APN 8 110355033 nonsense probably null
IGL01734:Hydin APN 8 110490789 nonsense probably null
IGL01743:Hydin APN 8 110592776 missense possibly damaging 0.94
IGL01829:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL01919:Hydin APN 8 110519174 missense possibly damaging 0.89
IGL01946:Hydin APN 8 110490718 missense possibly damaging 0.91
IGL01983:Hydin APN 8 110514895 missense probably benign 0.02
IGL02122:Hydin APN 8 110494415 missense possibly damaging 0.86
IGL02140:Hydin APN 8 110566938 missense probably benign
IGL02158:Hydin APN 8 110609966 missense possibly damaging 0.89
IGL02167:Hydin APN 8 110418423 missense possibly damaging 0.96
IGL02171:Hydin APN 8 110451958 nonsense probably null
IGL02185:Hydin APN 8 110506476 missense possibly damaging 0.86
IGL02517:Hydin APN 8 110566972 missense probably benign 0.01
IGL02639:Hydin APN 8 110538449 missense probably benign 0.01
IGL02644:Hydin APN 8 110538468 missense probably damaging 1.00
IGL02652:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL02658:Hydin APN 8 110413276 missense possibly damaging 0.86
IGL02706:Hydin APN 8 110410566 missense probably damaging 0.99
IGL02892:Hydin APN 8 110598959 missense possibly damaging 0.89
IGL02947:Hydin APN 8 110418462 missense probably damaging 0.96
IGL03136:Hydin APN 8 110418524 missense probably benign 0.22
IGL03248:Hydin APN 8 110595289 missense probably damaging 0.97
IGL03251:Hydin APN 8 110490596 missense probably damaging 1.00
IGL03350:Hydin APN 8 110312224 missense possibly damaging 0.86
IGL03366:Hydin APN 8 110267363 missense unknown
IGL03404:Hydin APN 8 110569777 missense probably benign 0.06
P0005:Hydin UTSW 8 110494289 critical splice acceptor site probably null
R0099:Hydin UTSW 8 110589561 missense probably damaging 1.00
R0125:Hydin UTSW 8 110462531 missense probably benign 0.12
R0157:Hydin UTSW 8 110300010 missense possibly damaging 0.86
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0255:Hydin UTSW 8 110565018 missense probably benign 0.00
R0352:Hydin UTSW 8 110569901 critical splice donor site probably null
R0379:Hydin UTSW 8 110509127 splice site probably benign
R0468:Hydin UTSW 8 110413223 missense possibly damaging 0.96
R0477:Hydin UTSW 8 110418498 missense probably damaging 1.00
R0479:Hydin UTSW 8 110599088 missense probably damaging 1.00
R0539:Hydin UTSW 8 110523072 missense probably benign
R0550:Hydin UTSW 8 110587775 missense probably benign 0.01
R0571:Hydin UTSW 8 110514103 splice site probably null
R0606:Hydin UTSW 8 110549798 splice site probably benign
R0789:Hydin UTSW 8 110566971 missense possibly damaging 0.53
R0849:Hydin UTSW 8 110598984 missense probably damaging 1.00
R0946:Hydin UTSW 8 110531053 missense probably benign 0.25
R1201:Hydin UTSW 8 110569855 missense probably benign 0.01
R1375:Hydin UTSW 8 110506222 critical splice donor site probably null
R1385:Hydin UTSW 8 110523204 missense probably benign 0.40
R1411:Hydin UTSW 8 110575031 missense probably benign 0.04
R1437:Hydin UTSW 8 110581985 nonsense probably null
R1447:Hydin UTSW 8 110523166 missense probably damaging 1.00
R1448:Hydin UTSW 8 110446585 missense probably benign 0.27
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1523:Hydin UTSW 8 110533271 missense probably benign 0.05
R1544:Hydin UTSW 8 110574854 missense probably benign 0.30
R1581:Hydin UTSW 8 110410460 missense probably benign
R1584:Hydin UTSW 8 110580815 missense probably benign 0.27
R1598:Hydin UTSW 8 110410674 missense possibly damaging 0.96
R1633:Hydin UTSW 8 110506982 missense probably benign 0.10
R1777:Hydin UTSW 8 110589571 missense probably benign 0.14
R1817:Hydin UTSW 8 110532827 missense probably benign 0.00
R1828:Hydin UTSW 8 110510894 missense probably benign 0.03
R1837:Hydin UTSW 8 110569625 missense probably benign 0.20
R1848:Hydin UTSW 8 110569808 missense probably benign 0.19
R1869:Hydin UTSW 8 110500705 missense possibly damaging 0.94
R1909:Hydin UTSW 8 110587772 missense probably damaging 1.00
R1928:Hydin UTSW 8 110502947 missense possibly damaging 0.93
R1950:Hydin UTSW 8 110609987 missense possibly damaging 0.64
R2095:Hydin UTSW 8 110462657 missense probably damaging 0.96
R2172:Hydin UTSW 8 110582049 missense probably benign 0.42
R2217:Hydin UTSW 8 110418506 missense probably benign
R2248:Hydin UTSW 8 110578203 missense probably benign 0.09
R2272:Hydin UTSW 8 110309132 missense probably benign 0.01
R2294:Hydin UTSW 8 110299959 missense probably damaging 0.99
R2315:Hydin UTSW 8 110398044 missense probably benign 0.01
R2330:Hydin UTSW 8 110565009 missense probably benign 0.01
R2374:Hydin UTSW 8 110565148 missense probably damaging 1.00
R2446:Hydin UTSW 8 110587715 missense possibly damaging 0.82
R2484:Hydin UTSW 8 110513115 missense possibly damaging 0.76
R2698:Hydin UTSW 8 110609929 missense possibly damaging 0.70
R2843:Hydin UTSW 8 110519114 missense probably benign
R2844:Hydin UTSW 8 110519114 missense probably benign
R2846:Hydin UTSW 8 110519114 missense probably benign
R2882:Hydin UTSW 8 110566923 missense possibly damaging 0.92
R2937:Hydin UTSW 8 110404295 missense possibly damaging 0.88
R3031:Hydin UTSW 8 110603216 missense possibly damaging 0.83
R3038:Hydin UTSW 8 110582689 missense probably damaging 1.00
R3121:Hydin UTSW 8 110506506 missense probably benign
R3157:Hydin UTSW 8 110267373 missense unknown
R3547:Hydin UTSW 8 110582067 missense possibly damaging 0.85
R3696:Hydin UTSW 8 110603279 missense probably damaging 1.00
R3850:Hydin UTSW 8 110563929 missense probably damaging 0.99
R3896:Hydin UTSW 8 110509079 missense possibly damaging 0.93
R3983:Hydin UTSW 8 110392325 missense probably damaging 1.00
R4031:Hydin UTSW 8 110610047 missense probably benign 0.30
R4072:Hydin UTSW 8 110505256 missense possibly damaging 0.68
R4095:Hydin UTSW 8 110541547 missense probably damaging 0.98
R4176:Hydin UTSW 8 110593820 missense probably benign 0.00
R4213:Hydin UTSW 8 110456507 missense possibly damaging 0.91
R4412:Hydin UTSW 8 110415736 missense probably damaging 0.99
R4471:Hydin UTSW 8 110587132 missense probably damaging 1.00
R4474:Hydin UTSW 8 110563865 missense probably benign 0.11
R4495:Hydin UTSW 8 110595402 missense probably damaging 0.99
R4508:Hydin UTSW 8 110519254 missense possibly damaging 0.91
R4578:Hydin UTSW 8 110267339 missense unknown
R4583:Hydin UTSW 8 110595225 missense probably benign 0.36
R4600:Hydin UTSW 8 110566950 missense probably benign 0.04
R4681:Hydin UTSW 8 110506471 missense possibly damaging 0.85
R4685:Hydin UTSW 8 110462522 missense probably damaging 0.99
R4689:Hydin UTSW 8 110595414 missense probably benign 0.18
R4735:Hydin UTSW 8 110555632 critical splice donor site probably null
R4736:Hydin UTSW 8 110523208 missense probably benign 0.02
R4740:Hydin UTSW 8 110446439 missense probably benign 0.06
R4771:Hydin UTSW 8 110532883 missense probably benign
R4777:Hydin UTSW 8 110410464 missense probably damaging 0.98
R4859:Hydin UTSW 8 110506494 missense possibly damaging 0.93
R4911:Hydin UTSW 8 110595438 missense probably benign 0.01
R4964:Hydin UTSW 8 110490673 missense possibly damaging 0.86
R4989:Hydin UTSW 8 110563922 missense possibly damaging 0.84
R4995:Hydin UTSW 8 110569642 missense probably damaging 0.97
R5059:Hydin UTSW 8 110505769 missense probably damaging 0.96
R5071:Hydin UTSW 8 110538473 missense probably benign 0.03
R5073:Hydin UTSW 8 110538473 missense probably benign 0.03
R5092:Hydin UTSW 8 110582668 missense probably benign 0.16
R5156:Hydin UTSW 8 110609701 missense probably benign 0.00
R5166:Hydin UTSW 8 110523142 missense possibly damaging 0.89
R5189:Hydin UTSW 8 110413211 critical splice acceptor site probably null
R5243:Hydin UTSW 8 110505748 missense possibly damaging 0.92
R5244:Hydin UTSW 8 110532819 missense possibly damaging 0.77
R5256:Hydin UTSW 8 110587223 missense possibly damaging 0.92
R5266:Hydin UTSW 8 110334784 missense possibly damaging 0.87
R5283:Hydin UTSW 8 110451980 missense possibly damaging 0.96
R5343:Hydin UTSW 8 110485419 missense probably benign 0.40
R5359:Hydin UTSW 8 110538372 missense probably benign 0.00
R5390:Hydin UTSW 8 110595467 missense probably benign
R5394:Hydin UTSW 8 110539842 splice site probably null
R5441:Hydin UTSW 8 110565109 missense possibly damaging 0.72
R5461:Hydin UTSW 8 110519231 missense probably damaging 0.96
R5662:Hydin UTSW 8 110580709 missense probably benign 0.02
R5695:Hydin UTSW 8 110535283 missense probably benign 0.35
R5732:Hydin UTSW 8 110452058 missense probably benign 0.03
R5774:Hydin UTSW 8 110571915 nonsense probably null
R5780:Hydin UTSW 8 110586080 missense probably damaging 1.00
R5787:Hydin UTSW 8 110326353 missense probably damaging 0.99
R5802:Hydin UTSW 8 110452060 missense possibly damaging 0.86
R5841:Hydin UTSW 8 110533214 missense possibly damaging 0.76
R5856:Hydin UTSW 8 110541842 missense probably damaging 0.99
R5893:Hydin UTSW 8 110490676 missense probably benign 0.12
R5963:Hydin UTSW 8 110494294 missense possibly damaging 0.93
R6008:Hydin UTSW 8 110599085 missense probably benign 0.02
R6019:Hydin UTSW 8 110566620 missense probably benign
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6133:Hydin UTSW 8 110601276 missense probably benign 0.00
R6135:Hydin UTSW 8 110462660 missense possibly damaging 0.85
R6157:Hydin UTSW 8 110528016 missense probably benign
R6209:Hydin UTSW 8 110593802 missense probably benign 0.05
R6238:Hydin UTSW 8 110392111 intron probably null
R6293:Hydin UTSW 8 110597911 missense possibly damaging 0.83
R6340:Hydin UTSW 8 110354942 splice site probably null
R6349:Hydin UTSW 8 110418459 nonsense probably null
R6357:Hydin UTSW 8 110541657 missense possibly damaging 0.86
R6385:Hydin UTSW 8 110312224 missense possibly damaging 0.86
R6396:Hydin UTSW 8 110506889 missense probably damaging 0.96
R6466:Hydin UTSW 8 110506968 missense possibly damaging 0.85
R6648:Hydin UTSW 8 110525667 intron probably null
R6671:Hydin UTSW 8 110601318 missense probably damaging 1.00
R6695:Hydin UTSW 8 110326460 missense probably benign 0.05
R6800:Hydin UTSW 8 110597971 missense probably benign 0.09
R6841:Hydin UTSW 8 110538375 missense probably benign 0.09
R6867:Hydin UTSW 8 110539802 missense probably benign 0.08
R6889:Hydin UTSW 8 110532856 missense possibly damaging 0.79
R6895:Hydin UTSW 8 110312251 missense probably benign 0.00
R6940:Hydin UTSW 8 110490611 missense probably damaging 1.00
R6951:Hydin UTSW 8 110398125 missense probably benign
R6981:Hydin UTSW 8 110531072 missense possibly damaging 0.89
X0063:Hydin UTSW 8 110551319 missense probably damaging 1.00
Z1088:Hydin UTSW 8 110299973 missense probably benign 0.12
Z1088:Hydin UTSW 8 110586048 missense probably benign 0.00
Z1088:Hydin UTSW 8 110592791 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGACCTGACCGTGTTTGAC -3'
(R):5'- TGCGGAAAGGTTCATATCAACAG -3'

Sequencing Primer
(F):5'- GTGTTTGACTTTGTCCACCGCAG -3'
(R):5'- CAGATGATATTGGACACATTGTGAGC -3'
Posted On2016-04-27