Incidental Mutation 'R0345:Sntb2'
ID38393
Institutional Source Beutler Lab
Gene Symbol Sntb2
Ensembl Gene ENSMUSG00000041308
Gene Namesyntrophin, basic 2
SynonymsSnt2
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R0345 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106935750-107019714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107001538 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 373 (S373P)
Ref Sequence ENSEMBL: ENSMUSP00000037324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047425] [ENSMUST00000212524]
Predicted Effect probably damaging
Transcript: ENSMUST00000047425
AA Change: S373P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037324
Gene: ENSMUSG00000041308
AA Change: S373P

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 62 92 N/A INTRINSIC
low complexity region 93 99 N/A INTRINSIC
PDZ 104 178 1.48e-17 SMART
PH 144 282 3.52e0 SMART
PH 306 419 4.07e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212524
AA Change: S373P

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have no overt phenotype. They are fertile and motile with no signs of muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Adgrb1 A G 15: 74,543,349 N641S probably damaging Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Ap2a2 T A 7: 141,631,293 M914K probably damaging Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Chrnb4 A G 9: 55,035,594 V132A probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Cyp2d37-ps A T 15: 82,689,774 noncoding transcript Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Llgl2 A G 11: 115,849,992 probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myo5c A G 9: 75,297,419 E1518G probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr670 T A 7: 104,960,181 M184L probably damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Olfr992 T C 2: 85,400,341 Q64R possibly damaging Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stap2 A G 17: 56,000,097 V217A probably damaging Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Synm C T 7: 67,735,821 V256I probably benign Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Zyg11b A G 4: 108,266,407 I121T probably damaging Het
Other mutations in Sntb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Sntb2 UTSW 8 107001583 missense probably damaging 1.00
R0766:Sntb2 UTSW 8 107001577 missense probably damaging 1.00
R1027:Sntb2 UTSW 8 106991571 missense probably benign 0.28
R1312:Sntb2 UTSW 8 107001577 missense probably damaging 1.00
R1514:Sntb2 UTSW 8 106991532 missense probably damaging 1.00
R1942:Sntb2 UTSW 8 107011352 missense probably damaging 0.98
R2937:Sntb2 UTSW 8 106936097 missense probably benign 0.06
R3968:Sntb2 UTSW 8 106997140 nonsense probably null
R4455:Sntb2 UTSW 8 106991607 critical splice donor site probably null
R4458:Sntb2 UTSW 8 106991607 critical splice donor site probably null
R4526:Sntb2 UTSW 8 107009963 missense probably damaging 0.99
R6123:Sntb2 UTSW 8 106981225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCCTGTGACACCAGGGACTAT -3'
(R):5'- TCAGCTCAGCAGCAGCATGGCA -3'

Sequencing Primer
(F):5'- gcaccgactgctcttcc -3'
(R):5'- AGCCCTGAACaagtattctggtc -3'
Posted On2013-05-23