Incidental Mutation 'R4965:Amph'
ID383950
Institutional Source Beutler Lab
Gene Symbol Amph
Ensembl Gene ENSMUSG00000021314
Gene Nameamphiphysin
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R4965 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location18948205-19150921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19137699 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 520 (S520N)
Ref Sequence ENSEMBL: ENSMUSP00000142766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]
Predicted Effect probably benign
Transcript: ENSMUST00000003345
AA Change: S516N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: S516N

DomainStartEndE-ValueType
BAR 12 233 8.47e-80 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
low complexity region 479 499 N/A INTRINSIC
SH3 616 686 7.82e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197545
Predicted Effect probably benign
Transcript: ENSMUST00000200466
AA Change: S520N

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: S520N

DomainStartEndE-ValueType
BAR 12 233 2.3e-82 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 428 449 N/A INTRINSIC
low complexity region 483 503 N/A INTRINSIC
SH3 620 690 4.9e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222698
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,672 T1541A probably benign Het
2810474O19Rik G T 6: 149,328,398 G981* probably null Het
4931423N10Rik C A 2: 23,245,115 T312K probably benign Het
9530002B09Rik T C 4: 122,700,492 M59T probably benign Het
Adam18 C T 8: 24,641,811 C428Y probably damaging Het
Adcy5 A G 16: 35,278,502 E700G possibly damaging Het
Adprh G T 16: 38,445,780 Y333* probably null Het
Agfg2 C A 5: 137,667,177 probably null Het
Akip1 A T 7: 109,711,754 E167V probably damaging Het
Akr1c21 A T 13: 4,580,305 Q199L probably damaging Het
Aldh9a1 C A 1: 167,365,789 A455E probably damaging Het
Ankrd52 A G 10: 128,390,507 D1006G probably benign Het
Ap5z1 A C 5: 142,467,676 Q133P probably damaging Het
Babam1 C T 8: 71,404,388 A331V possibly damaging Het
Btc T C 5: 91,362,301 probably null Het
Cacna2d3 A G 14: 28,982,332 F831L probably benign Het
Cadm3 G A 1: 173,337,097 P372L probably damaging Het
Capn5 A T 7: 98,126,417 M439K probably damaging Het
Carf T C 1: 60,150,637 S639P probably damaging Het
Casp12 C T 9: 5,352,250 R81C probably benign Het
Ces2e G T 8: 104,933,698 R555M probably benign Het
Cfap54 T A 10: 93,066,799 I164F probably benign Het
Cltc C T 11: 86,707,501 V1012I probably damaging Het
Cmya5 G A 13: 93,095,787 T931I possibly damaging Het
Cntn6 A G 6: 104,774,474 I364V probably damaging Het
Cntnap1 A T 11: 101,177,425 I59F possibly damaging Het
Cop1 T C 1: 159,239,597 M80T probably damaging Het
Cplx2 A G 13: 54,379,647 S115G possibly damaging Het
Crtac1 A G 19: 42,318,740 Y195H probably damaging Het
Csn1s2a A C 5: 87,781,838 S99R possibly damaging Het
Csn1s2b T A 5: 87,813,961 D41E possibly damaging Het
Cul9 C T 17: 46,538,525 D565N probably damaging Het
Cux1 A T 5: 136,311,556 N625K possibly damaging Het
Cyp2c37 A T 19: 40,011,762 M443L possibly damaging Het
Cyp2s1 G A 7: 25,809,285 T244I possibly damaging Het
Dgkh C T 14: 78,624,421 V135M probably damaging Het
Dtl T C 1: 191,546,565 E395G possibly damaging Het
Dyrk1a G T 16: 94,691,995 G658* probably null Het
Erlin2 T C 8: 27,029,595 F117S probably damaging Het
Fkbp8 A G 8: 70,531,523 probably null Het
Fras1 T C 5: 96,726,580 F2288S possibly damaging Het
Frmd3 A G 4: 74,153,600 T240A probably damaging Het
H2-D1 A G 17: 35,263,905 Y137C probably damaging Het
Helz2 A G 2: 181,240,916 V28A possibly damaging Het
Hydin A G 8: 110,398,095 I579V probably benign Het
Il6 A T 5: 30,013,493 Y29F possibly damaging Het
Ildr2 A G 1: 166,307,840 D368G probably damaging Het
Junb T A 8: 84,978,159 I91F probably damaging Het
Kat2a C A 11: 100,712,203 probably benign Het
Kat2a A T 11: 100,712,204 probably benign Het
Kcnh5 T A 12: 74,965,151 T665S probably benign Het
Kdm1b A T 13: 47,074,367 D608V probably damaging Het
Krcc1 A G 6: 71,284,637 K218E probably damaging Het
Krt8 C T 15: 101,996,951 V488M probably benign Het
Lzts1 C T 8: 69,138,762 A245T probably benign Het
Mcm6 T A 1: 128,359,486 Q27L probably damaging Het
Mfsd4b3 G T 10: 39,947,690 Y191* probably null Het
Mgme1 C T 2: 144,276,404 Q199* probably null Het
Mgme1 T C 2: 144,279,620 L332P probably benign Het
Morc3 G T 16: 93,860,587 E25* probably null Het
Mroh7 G A 4: 106,690,987 A1098V possibly damaging Het
Mtrf1 G A 14: 79,406,587 R174H probably benign Het
Mybpc3 G A 2: 91,119,247 G45D possibly damaging Het
Mycbpap A T 11: 94,504,938 N733K probably damaging Het
N4bp1 T C 8: 86,851,686 I684V possibly damaging Het
Nav2 A T 7: 49,552,877 R1470* probably null Het
Ndufa9 A T 6: 126,822,063 S364T probably benign Het
Nipal4 C A 11: 46,162,010 A43S possibly damaging Het
Nlrp1a T A 11: 71,092,315 Y1275F possibly damaging Het
Nova1 A T 12: 46,720,835 L8* probably null Het
Odam G T 5: 87,890,108 G181* probably null Het
Olfr1111 T A 2: 87,150,659 M1L possibly damaging Het
Olfr1297 T C 2: 111,621,534 D180G probably damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Olfr186 A T 16: 59,027,333 D191E probably damaging Het
Olfr283 T C 15: 98,379,149 probably benign Het
Olfr33 A T 7: 102,713,495 I306N probably damaging Het
Olfr723 C T 14: 49,928,897 V216I probably benign Het
Optn T A 2: 5,021,379 Q576L probably benign Het
Patl2 G T 2: 122,128,848 S45* probably null Het
Pde2a G A 7: 101,502,933 G349E probably benign Het
Pdlim2 T A 14: 70,168,015 probably benign Het
Per1 T C 11: 69,104,401 V653A probably benign Het
Phlda2 A G 7: 143,502,268 S75P probably damaging Het
Poldip3 A T 15: 83,137,505 M167K possibly damaging Het
Prpf38a T C 4: 108,579,081 I12V probably benign Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Ptges3l A T 11: 101,424,622 M1K probably null Het
Rdh5 A G 10: 128,913,784 Y296H probably damaging Het
Rnf2 T A 1: 151,473,217 K51* probably null Het
Rpusd3 C A 6: 113,416,848 R215L probably benign Het
Rsph4a A T 10: 33,909,240 E382D probably damaging Het
S1pr2 G A 9: 20,968,449 Q28* probably null Het
Sesn1 A T 10: 41,895,009 I179F probably damaging Het
Setd3 T A 12: 108,113,371 E291V probably benign Het
Shc1 G T 3: 89,426,996 R323L probably damaging Het
Slc22a5 T C 11: 53,891,526 D5G possibly damaging Het
Slc6a19 T C 13: 73,700,558 K26E probably benign Het
Slc9a3 A G 13: 74,164,293 N670D possibly damaging Het
Spata19 A T 9: 27,400,465 I127L probably benign Het
Speg G T 1: 75,427,703 V2751L probably damaging Het
Sptbn2 A G 19: 4,729,309 D298G probably benign Het
Srm T C 4: 148,594,183 V289A possibly damaging Het
Stip1 C T 19: 7,035,570 A49T probably benign Het
Tas2r118 C A 6: 23,969,628 V145F probably benign Het
Tbc1d12 A T 19: 38,865,725 K284* probably null Het
Tfcp2 T C 15: 100,525,650 H125R probably damaging Het
Tfdp1 T C 8: 13,373,073 V206A probably damaging Het
Tgtp2 A G 11: 49,059,410 W112R probably damaging Het
Tmem71 T G 15: 66,538,861 M221L probably benign Het
Tpcn1 T C 5: 120,547,487 N436S possibly damaging Het
Usp4 C T 9: 108,362,620 L183F probably damaging Het
Vmn2r55 A T 7: 12,670,551 N308K possibly damaging Het
Zfp106 T A 2: 120,533,919 D669V probably damaging Het
Zfp108 A T 7: 24,260,148 I55L probably benign Het
Zfp512b A T 2: 181,586,338 S8R probably damaging Het
Zfp827 T C 8: 79,061,281 S359P probably benign Het
Other mutations in Amph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Amph APN 13 19120606 missense probably damaging 1.00
IGL01866:Amph APN 13 19142002 missense probably damaging 1.00
IGL02157:Amph APN 13 19104231 missense possibly damaging 0.60
IGL02300:Amph APN 13 19086604 missense probably damaging 1.00
IGL02435:Amph APN 13 19139163
IGL03060:Amph APN 13 19094814 missense probably damaging 0.99
IGL03122:Amph APN 13 19102943 missense probably damaging 0.98
R0037:Amph UTSW 13 19100653 missense possibly damaging 0.90
R0646:Amph UTSW 13 19113116 missense possibly damaging 0.95
R0652:Amph UTSW 13 19086621 splice site probably null
R1005:Amph UTSW 13 19142028 missense probably damaging 0.97
R1006:Amph UTSW 13 19142028 missense probably damaging 0.97
R1199:Amph UTSW 13 19142028 missense probably damaging 0.97
R1200:Amph UTSW 13 19142028 missense probably damaging 0.97
R1201:Amph UTSW 13 19142028 missense probably damaging 0.97
R1333:Amph UTSW 13 19142028 missense probably damaging 0.97
R1334:Amph UTSW 13 19142028 missense probably damaging 0.97
R1335:Amph UTSW 13 19142028 missense probably damaging 0.97
R1337:Amph UTSW 13 19142028 missense probably damaging 0.97
R1338:Amph UTSW 13 19142028 missense probably damaging 0.97
R1384:Amph UTSW 13 19142028 missense probably damaging 0.97
R1397:Amph UTSW 13 19142028 missense probably damaging 0.97
R1501:Amph UTSW 13 19104291 nonsense probably null
R1528:Amph UTSW 13 19142028 missense probably damaging 0.97
R1822:Amph UTSW 13 18948455 missense probably damaging 0.98
R2004:Amph UTSW 13 19142028 missense probably damaging 0.97
R2006:Amph UTSW 13 19142028 missense probably damaging 0.97
R2061:Amph UTSW 13 19125035 nonsense probably null
R2111:Amph UTSW 13 19116266 splice site probably benign
R2329:Amph UTSW 13 19139350 missense probably benign
R2878:Amph UTSW 13 19104267 missense possibly damaging 0.95
R3121:Amph UTSW 13 19113146 nonsense probably null
R3548:Amph UTSW 13 19102959 missense probably damaging 1.00
R4059:Amph UTSW 13 19141998 missense probably damaging 1.00
R4369:Amph UTSW 13 19137700 missense probably benign 0.20
R4492:Amph UTSW 13 19149758 missense possibly damaging 0.76
R4855:Amph UTSW 13 19084208 missense probably damaging 1.00
R4937:Amph UTSW 13 19104345 missense probably damaging 1.00
R5777:Amph UTSW 13 19046016 missense probably damaging 1.00
R5787:Amph UTSW 13 18948454 missense possibly damaging 0.75
R6091:Amph UTSW 13 19125123 missense probably benign 0.01
V1662:Amph UTSW 13 19139370 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CTCGTGAAGGTTGTGGAGAC -3'
(R):5'- TTCCCTCTATCATGACTGAAGC -3'

Sequencing Primer
(F):5'- GAGACACAGGCATAGTGACTTCC -3'
(R):5'- ATCATGACTGAAGCTTCTTTCTCC -3'
Posted On2016-04-27