Incidental Mutation 'R0345:Llgl2'
ID38402
Institutional Source Beutler Lab
Gene Symbol Llgl2
Ensembl Gene ENSMUSG00000020782
Gene NameLLGL2 scribble cell polarity complex component
Synonyms9130006H11Rik
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R0345 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115824049-115855780 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 115849992 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000133250] [ENSMUST00000137900] [ENSMUST00000155878] [ENSMUST00000173289] [ENSMUST00000177736]
Predicted Effect probably benign
Transcript: ENSMUST00000103032
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130518
Predicted Effect probably benign
Transcript: ENSMUST00000133250
SMART Domains Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 2e-20 BLAST
SCOP:d1gxra_ 19 118 5e-8 SMART
Blast:WD40 62 101 4e-22 BLAST
Blast:WD40 112 146 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137900
SMART Domains Protein: ENSMUSP00000119675
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 3e-20 BLAST
SCOP:d1gxra_ 19 158 7e-9 SMART
Blast:WD40 62 101 6e-22 BLAST
Blast:WD40 112 157 2e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147878
Predicted Effect probably benign
Transcript: ENSMUST00000155878
SMART Domains Protein: ENSMUSP00000117649
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 1e-20 BLAST
SCOP:d1gxra_ 19 118 3e-8 SMART
Blast:WD40 62 101 3e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173289
SMART Domains Protein: ENSMUSP00000133790
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 2e-20 BLAST
SCOP:d1gxra_ 19 118 5e-8 SMART
Blast:WD40 62 101 4e-22 BLAST
Blast:WD40 112 148 4e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177736
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Adgrb1 A G 15: 74,543,349 N641S probably damaging Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Ap2a2 T A 7: 141,631,293 M914K probably damaging Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Chrnb4 A G 9: 55,035,594 V132A probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Cyp2d37-ps A T 15: 82,689,774 noncoding transcript Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myo5c A G 9: 75,297,419 E1518G probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr670 T A 7: 104,960,181 M184L probably damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Olfr992 T C 2: 85,400,341 Q64R possibly damaging Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sntb2 T C 8: 107,001,538 S373P probably damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stap2 A G 17: 56,000,097 V217A probably damaging Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Synm C T 7: 67,735,821 V256I probably benign Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Zyg11b A G 4: 108,266,407 I121T probably damaging Het
Other mutations in Llgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Llgl2 APN 11 115834884 missense probably benign 0.00
IGL01145:Llgl2 APN 11 115853805 missense probably benign
IGL01344:Llgl2 APN 11 115851193 missense probably benign 0.01
IGL01980:Llgl2 APN 11 115850025 missense probably damaging 1.00
IGL02220:Llgl2 APN 11 115845379 missense possibly damaging 0.64
IGL02341:Llgl2 APN 11 115851120 missense possibly damaging 0.70
IGL02399:Llgl2 APN 11 115844835 missense probably damaging 0.97
IGL02415:Llgl2 APN 11 115853285 missense probably damaging 0.98
IGL02632:Llgl2 APN 11 115844872 missense probably damaging 1.00
IGL02990:Llgl2 APN 11 115854333 missense probably benign 0.01
IGL03405:Llgl2 APN 11 115850842 missense probably benign 0.09
R0097:Llgl2 UTSW 11 115844497 nonsense probably null
R0166:Llgl2 UTSW 11 115844854 missense probably damaging 1.00
R0277:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0323:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0614:Llgl2 UTSW 11 115850267 missense probably damaging 1.00
R0980:Llgl2 UTSW 11 115850001 missense probably damaging 1.00
R1387:Llgl2 UTSW 11 115853132 missense probably damaging 0.99
R1456:Llgl2 UTSW 11 115845499 missense probably benign 0.00
R1541:Llgl2 UTSW 11 115853121 missense probably benign 0.00
R1832:Llgl2 UTSW 11 115851100 missense probably damaging 1.00
R1950:Llgl2 UTSW 11 115851066 missense probably damaging 0.96
R2991:Llgl2 UTSW 11 115851120 missense probably benign 0.05
R4018:Llgl2 UTSW 11 115847612 missense probably benign 0.31
R4582:Llgl2 UTSW 11 115850706 missense possibly damaging 0.89
R4729:Llgl2 UTSW 11 115848299 missense probably damaging 0.98
R4907:Llgl2 UTSW 11 115853974 nonsense probably null
R5000:Llgl2 UTSW 11 115844902 missense probably benign
R5016:Llgl2 UTSW 11 115853424 missense probably damaging 1.00
R5175:Llgl2 UTSW 11 115850721 missense probably damaging 1.00
R5857:Llgl2 UTSW 11 115850281 missense probably damaging 1.00
R6190:Llgl2 UTSW 11 115846986 missense probably benign 0.00
R6451:Llgl2 UTSW 11 115844941 missense probably damaging 0.99
R6804:Llgl2 UTSW 11 115843315 critical splice acceptor site probably null
R6909:Llgl2 UTSW 11 115850799 missense probably damaging 1.00
X0058:Llgl2 UTSW 11 115850637 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTATGGGAACGCATCATCGC -3'
(R):5'- GGATCATCGCTGTAGGGATCAAAGG -3'

Sequencing Primer
(F):5'- TCTAGGAGTGGCCCATAGATG -3'
(R):5'- GGATCAAAGGAGCCCACCTG -3'
Posted On2013-05-23