Incidental Mutation 'R4966:Actn1'
ID384032
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Nameactinin, alpha 1
Synonyms
MMRRC Submission 042562-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.500) question?
Stock #R4966 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80167547-80260371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80173130 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 656 (I656V)
Ref Sequence ENSEMBL: ENSMUSP00000127176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
Predicted Effect probably benign
Transcript: ENSMUST00000021554
AA Change: I656V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: I656V

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167327
AA Change: I656V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: I656V

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219634
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 96% (94/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,474,221 probably benign Het
9030619P08Rik T A 15: 75,431,418 noncoding transcript Het
Abcb5 T A 12: 118,886,891 probably benign Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Arhgef15 A G 11: 68,947,317 V659A probably benign Het
AW551984 T C 9: 39,597,176 E348G possibly damaging Het
Bbs2 A T 8: 94,080,807 V453E probably damaging Het
Caskin1 A T 17: 24,507,161 D1414V probably damaging Het
Ccdc57 A T 11: 120,861,152 S868T probably benign Het
Cdc34b A T 11: 94,742,261 I96F probably damaging Het
Ctnnd1 A G 2: 84,622,073 F69L possibly damaging Het
Cyld A G 8: 88,742,301 I567V possibly damaging Het
Dact3 G C 7: 16,886,088 V503L unknown Het
Dlg1 C T 16: 31,754,808 T9I probably benign Het
Dnase1 T C 16: 4,037,907 probably benign Het
Drc7 G A 8: 95,071,596 E490K probably benign Het
Drd4 T C 7: 141,293,777 M114T probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
Fgfr1 C A 8: 25,572,445 Y665* probably null Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gnat1 A T 9: 107,677,234 M115K probably benign Het
Gpr45 A G 1: 43,033,120 T308A probably benign Het
Grm1 T A 10: 10,719,665 K740* probably null Het
Gtsf2 T C 15: 103,444,328 E88G possibly damaging Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ino80c T C 18: 24,106,645 D153G probably damaging Het
Ints11 T C 4: 155,886,928 F278L probably damaging Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mipep G T 14: 60,784,782 R32L probably damaging Het
Mon1a A G 9: 107,902,651 E473G probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Myh11 T C 16: 14,205,954 E1512G probably damaging Het
Myo5c T C 9: 75,269,596 S608P probably benign Het
Myo9a A G 9: 59,871,734 D1591G probably benign Het
Myof T A 19: 37,935,852 I1306F probably damaging Het
Nlgn1 C T 3: 25,920,237 G165D possibly damaging Het
Noc2l C G 4: 156,245,911 D513E probably damaging Het
Nup205 G A 6: 35,243,849 R1862H probably benign Het
Nup210l A G 3: 90,106,901 H65R probably benign Het
Olfr1388 A G 11: 49,444,118 D89G possibly damaging Het
Olfr827 A T 10: 130,210,437 M231K probably benign Het
Pcmtd1 C A 1: 7,161,009 Y176* probably null Het
Pde6h C T 6: 136,961,203 T58I possibly damaging Het
Pkd1 T C 17: 24,586,068 probably null Het
Polr1e G A 4: 45,029,429 A297T probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rdx T C 9: 52,075,009 V372A probably benign Het
Reep6 T A 10: 80,333,799 F107Y probably benign Het
Rere G T 4: 150,613,816 probably benign Het
Rmdn2 G T 17: 79,666,875 A266S probably damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Rnpepl1 A T 1: 92,916,761 N325I probably damaging Het
Rps6ka5 T A 12: 100,553,066 M763L probably benign Het
Ryr2 T C 13: 11,714,611 E2375G possibly damaging Het
Ryr2 T C 13: 11,833,992 T361A probably benign Het
Serpina3j T A 12: 104,319,784 C399* probably null Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Sim2 T C 16: 94,123,421 V475A probably benign Het
Slc24a5 G A 2: 125,068,268 V30I probably benign Het
Snrnp25 A G 11: 32,207,595 K58E probably damaging Het
Stx1b T C 7: 127,807,921 I55V probably damaging Het
Tacc2 T C 7: 130,728,777 S264P probably damaging Het
Tbc1d4 A T 14: 101,458,174 Y943N probably damaging Het
Tlr5 T C 1: 182,973,473 I114T probably benign Het
Tm2d3 A G 7: 65,697,721 N101S possibly damaging Het
Tmem201 G T 4: 149,718,687 Q575K probably benign Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trak2 G A 1: 58,919,321 T267I probably damaging Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Ttbk2 A T 2: 120,773,277 F258L possibly damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn T C 2: 76,955,036 D665G probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Unc93b1 T C 19: 3,942,023 probably null Het
Uroc1 T C 6: 90,345,394 L300P probably damaging Het
Vmn2r67 A T 7: 85,136,385 V804E probably damaging Het
Wdr81 T A 11: 75,445,949 Q1538L probably benign Het
Zfp457 T A 13: 67,293,278 H315L probably damaging Het
Zfp518a T A 19: 40,915,851 V1408D possibly damaging Het
Zfp52 T G 17: 21,560,403 L171R probably benign Het
Zfp712 C T 13: 67,040,612 C617Y probably damaging Het
Zfp770 T C 2: 114,197,387 N67S probably benign Het
Zmat4 T C 8: 23,902,069 S83P probably damaging Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80199072 splice site probably null
IGL01152:Actn1 APN 12 80199046 missense probably damaging 1.00
IGL01386:Actn1 APN 12 80193672 missense probably benign 0.03
IGL01890:Actn1 APN 12 80184868 missense probably damaging 0.99
IGL01937:Actn1 APN 12 80171763 missense probably benign 0.03
IGL02142:Actn1 APN 12 80176155 critical splice donor site probably null
IGL02191:Actn1 APN 12 80174109 missense probably benign
IGL02217:Actn1 APN 12 80174094 nonsense probably null
IGL02230:Actn1 APN 12 80171830 missense probably benign 0.02
IGL03163:Actn1 APN 12 80181417 missense probably benign 0.33
IGL03401:Actn1 APN 12 80168967 nonsense probably null
R0538:Actn1 UTSW 12 80260100 unclassified probably benign
R0546:Actn1 UTSW 12 80178434 missense probably benign
R0583:Actn1 UTSW 12 80199029 missense probably damaging 1.00
R0606:Actn1 UTSW 12 80174647 splice site probably benign
R1340:Actn1 UTSW 12 80173144 critical splice acceptor site probably null
R1519:Actn1 UTSW 12 80205078 missense probably damaging 1.00
R1572:Actn1 UTSW 12 80172957 splice site probably benign
R1619:Actn1 UTSW 12 80173022 missense probably damaging 1.00
R1677:Actn1 UTSW 12 80260032 missense probably benign 0.02
R1994:Actn1 UTSW 12 80204971 nonsense probably null
R2102:Actn1 UTSW 12 80183517 missense probably benign 0.38
R2157:Actn1 UTSW 12 80173117 missense probably benign 0.04
R2191:Actn1 UTSW 12 80171802 nonsense probably null
R2519:Actn1 UTSW 12 80192389 missense probably damaging 1.00
R2988:Actn1 UTSW 12 80192388 missense possibly damaging 0.78
R4024:Actn1 UTSW 12 80168477 missense probably damaging 1.00
R4589:Actn1 UTSW 12 80171799 missense possibly damaging 0.53
R4907:Actn1 UTSW 12 80181414 missense probably damaging 0.99
R4936:Actn1 UTSW 12 80172998 missense probably benign 0.09
R4972:Actn1 UTSW 12 80173039 missense probably benign 0.35
R5395:Actn1 UTSW 12 80170703 missense probably benign
R5460:Actn1 UTSW 12 80183568 missense probably benign 0.00
R5467:Actn1 UTSW 12 80176217 missense possibly damaging 0.86
R5470:Actn1 UTSW 12 80168941 missense probably damaging 0.99
R5661:Actn1 UTSW 12 80184844 missense probably benign 0.09
R5985:Actn1 UTSW 12 80168395 missense probably damaging 1.00
R6020:Actn1 UTSW 12 80174455 splice site probably null
R6042:Actn1 UTSW 12 80177249 missense probably benign 0.04
R6389:Actn1 UTSW 12 80174522 missense probably benign
R6499:Actn1 UTSW 12 80168417 missense possibly damaging 0.59
R6709:Actn1 UTSW 12 80193644 missense probably damaging 1.00
R7016:Actn1 UTSW 12 80172968 missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80204977 missense probably damaging 1.00
R7173:Actn1 UTSW 12 80177259 missense possibly damaging 0.70
R7183:Actn1 UTSW 12 80168932 missense possibly damaging 0.87
R7291:Actn1 UTSW 12 80174085 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATTCATTGGGAGATGCTACC -3'
(R):5'- CTATCAAGGAACGTCCACGC -3'

Sequencing Primer
(F):5'- TCATTGGGAGATGCTACCCCAAATG -3'
(R):5'- GGAACGTCCACGCTAAATAGCTTTC -3'
Posted On2016-04-27