Incidental Mutation 'R4967:Sec16a'
ID384074
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene NameSEC16 homolog A, endoplasmic reticulum export factor
SynonymsC230052J16Rik
MMRRC Submission 042563-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4967 (G1)
Quality Score219
Status Validated
Chromosome2
Chromosomal Location26409431-26445216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26412871 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2344 (S2344P)
Ref Sequence ENSEMBL: ENSMUSP00000109716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082] [ENSMUST00000114090] [ENSMUST00000145701]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028291
Predicted Effect probably benign
Transcript: ENSMUST00000091252
AA Change: S2324P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: S2324P

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114082
AA Change: S2344P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: S2344P

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114090
SMART Domains Protein: ENSMUSP00000109724
Gene: ENSMUSG00000026925

DomainStartEndE-ValueType
low complexity region 277 294 N/A INTRINSIC
IPPc 300 602 1.27e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145701
SMART Domains Protein: ENSMUSP00000119485
Gene: ENSMUSG00000026925

DomainStartEndE-ValueType
low complexity region 277 294 N/A INTRINSIC
IPPc 300 602 1.27e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154486
Predicted Effect unknown
Transcript: ENSMUST00000156442
AA Change: S873P
SMART Domains Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924
AA Change: S873P

DomainStartEndE-ValueType
Pfam:Sec16 14 114 7.7e-11 PFAM
low complexity region 150 164 N/A INTRINSIC
Pfam:Sec16_C 186 438 1.6e-45 PFAM
low complexity region 659 674 N/A INTRINSIC
low complexity region 715 727 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 777 792 N/A INTRINSIC
Meta Mutation Damage Score 0.1544 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,728 Y199* probably null Het
Adhfe1 A T 1: 9,566,804 I394F probably benign Het
Arhgap26 G T 18: 39,246,840 R485L probably damaging Het
Atat1 T A 17: 35,901,575 N231I probably damaging Het
B4galnt2 T C 11: 95,869,274 N309S probably benign Het
Bank1 A T 3: 136,066,373 F499I probably damaging Het
Bcl9l A G 9: 44,505,068 D146G possibly damaging Het
Bglap3 A T 3: 88,376,364 probably benign Het
Bscl2 C A 19: 8,847,980 T376K probably benign Het
C87499 T C 4: 88,629,195 T80A probably damaging Het
Cercam A T 2: 29,871,021 probably null Het
Clec4f C T 6: 83,656,030 M1I probably null Het
Clec4n A T 6: 123,232,107 I14F probably benign Het
Cmya5 T C 13: 93,090,585 E2665G probably damaging Het
Cog4 T A 8: 110,852,283 probably null Het
Cubn A G 2: 13,348,045 F1961L probably benign Het
Cyp4a29 A T 4: 115,246,999 H88L probably benign Het
Dhdh A G 7: 45,479,106 L216P probably damaging Het
Dpp6 T C 5: 27,666,511 F544S probably damaging Het
Dthd1 C T 5: 62,888,206 T771I probably benign Het
Dusp27 A T 1: 166,127,106 V25E probably damaging Het
Emc10 A G 7: 44,493,188 probably null Het
Fam198a C T 9: 121,965,718 R313W probably damaging Het
Fgg A T 3: 83,012,765 T284S probably benign Het
Gm3002 T A 14: 3,824,737 N24K probably damaging Het
Gm8674 G A 13: 49,901,998 noncoding transcript Het
Gpr63 G A 4: 25,008,368 W364* probably null Het
Hcn4 C G 9: 58,859,828 P891A unknown Het
Hcrtr1 A T 4: 130,130,999 F365I possibly damaging Het
Hmcn2 A G 2: 31,354,164 probably null Het
Hoxc5 T A 15: 103,015,354 L194H probably damaging Het
Ifna11 A G 4: 88,820,050 N31S probably null Het
Ikbke GCC G 1: 131,275,267 probably null Het
Iqgap2 A T 13: 95,630,006 D1496E probably benign Het
Kif28 G T 1: 179,708,442 Q556K probably damaging Het
Klhl42 C T 6: 147,108,004 T447I possibly damaging Het
Lrp1b A C 2: 41,788,974 D35E probably damaging Het
Lsm14b A G 2: 180,033,899 probably benign Het
Map3k1 T C 13: 111,772,738 E226G probably damaging Het
Map3k14 T A 11: 103,239,531 N187Y probably benign Het
Mcm6 A T 1: 128,335,849 V645E probably damaging Het
Mdh1b G T 1: 63,719,863 P190Q probably damaging Het
Meiob T G 17: 24,818,379 L77R probably damaging Het
Mkl1 C A 15: 81,045,275 probably benign Het
Mrgpra3 A T 7: 47,589,519 F220I probably benign Het
Mtor T A 4: 148,491,360 S1324T possibly damaging Het
Myot T A 18: 44,354,928 D437E possibly damaging Het
Ncoa6 G T 2: 155,421,332 T394K possibly damaging Het
Nf1 T A 11: 79,565,553 probably null Het
Nup210 T A 6: 91,036,469 T1190S possibly damaging Het
Odf1 T A 15: 38,226,408 I184N probably damaging Het
Olfr178 G T 16: 58,889,594 Q209K possibly damaging Het
Olfr270 T C 4: 52,970,960 V113A possibly damaging Het
Olfr353 A G 2: 36,890,707 I47T probably damaging Het
Olfr959 C T 9: 39,572,758 C167Y probably damaging Het
Padi1 A G 4: 140,845,590 V21A probably benign Het
Pdzrn3 C T 6: 101,151,590 R705H probably damaging Het
Pik3cb T C 9: 99,105,632 I18V probably benign Het
Pmpca T C 2: 26,390,308 S117P probably damaging Het
Poteg T A 8: 27,494,981 probably benign Het
Rab30 G A 7: 92,829,563 R72H probably damaging Het
Ramp2 T A 11: 101,247,557 probably null Het
Rbks G A 5: 31,624,532 T308I probably damaging Het
Rnf112 A G 11: 61,452,926 probably benign Het
Rnf38 G A 4: 44,152,460 P3S probably damaging Het
Slc16a8 C T 15: 79,252,884 V109M possibly damaging Het
Slc28a1 A T 7: 81,142,009 T308S possibly damaging Het
Slc39a3 T C 10: 81,031,619 T98A possibly damaging Het
Smarcc2 T C 10: 128,483,180 F731L probably damaging Het
Smc4 A G 3: 69,018,239 probably benign Het
Sparcl1 T G 5: 104,092,910 D216A probably damaging Het
Speg G A 1: 75,387,869 R192H probably damaging Het
Sspo T C 6: 48,464,605 L1892P probably damaging Het
Tacc2 A G 7: 130,623,948 N807D probably damaging Het
Teddm1a A T 1: 153,892,233 K148* probably null Het
Tex15 T A 8: 33,574,470 D1309E probably benign Het
Thbs1 A T 2: 118,114,778 E277D probably benign Het
Ticrr G A 7: 79,660,410 R24Q probably damaging Het
Tigd4 A G 3: 84,595,153 E459G probably benign Het
Tln2 C A 9: 67,355,125 A615S probably damaging Het
Tmprss5 T C 9: 49,115,517 V410A probably damaging Het
Tnrc6a G T 7: 123,189,872 W1638L probably damaging Het
Tpr A G 1: 150,410,059 D424G probably damaging Het
Trim34a A T 7: 104,261,064 K358* probably null Het
Tssk5 T A 15: 76,374,656 D10V possibly damaging Het
Usp35 A C 7: 97,313,575 L470R probably damaging Het
Usp42 T C 5: 143,715,364 D968G possibly damaging Het
Utrn A G 10: 12,455,420 V2924A probably damaging Het
Wdtc1 C A 4: 133,294,343 A627S probably damaging Het
Xrra1 A G 7: 99,906,523 T366A probably damaging Het
Zfp712 T A 13: 67,040,709 K585* probably null Het
Zfp97 T A 17: 17,145,131 N297K probably damaging Het
Zfp97 G T 17: 17,144,676 E146* probably null Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1959:Sec16a UTSW 2 26430132 missense probably benign 0.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2075:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2520:Sec16a UTSW 2 26441356 nonsense probably null
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3508:Sec16a UTSW 2 26425850 missense probably damaging 1.00
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4611:Sec16a UTSW 2 26441805 missense probably benign 0.04
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 unclassified probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5875:Sec16a UTSW 2 26433367 missense probably damaging 1.00
R5906:Sec16a UTSW 2 26438831 missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6657:Sec16a UTSW 2 26425864 nonsense probably null
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6860:Sec16a UTSW 2 26430112 missense probably damaging 1.00
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCCCTGACCCTGAAGAGC -3'
(R):5'- AGAACTGTCTCTCTGGAGCC -3'

Sequencing Primer
(F):5'- CTACAGAGTGAGTTCTAGGACAGCC -3'
(R):5'- AGAACTGTCTCTCTGGAGCCTATTTG -3'
Posted On2016-04-27