Incidental Mutation 'R4967:Thbs1'
ID384080
Institutional Source Beutler Lab
Gene Symbol Thbs1
Ensembl Gene ENSMUSG00000040152
Gene Namethrombospondin 1
SynonymsTSP-1, TSP1, tbsp1, Thbs-1
MMRRC Submission 042563-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R4967 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118111876-118127133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118114778 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 277 (E277D)
Ref Sequence ENSEMBL: ENSMUSP00000044903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039559]
Predicted Effect probably benign
Transcript: ENSMUST00000039559
AA Change: E277D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152
AA Change: E277D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TSPN 24 221 2.68e-60 SMART
low complexity region 237 249 N/A INTRINSIC
coiled coil region 292 315 N/A INTRINSIC
VWC 319 373 3.6e-20 SMART
TSP1 383 430 4.21e-12 SMART
TSP1 439 491 3.04e-18 SMART
TSP1 496 548 8.6e-18 SMART
EGF 551 588 3.88e-3 SMART
EGF 592 646 1.69e1 SMART
EGF 650 691 7.13e-2 SMART
Pfam:TSP_3 728 763 5.8e-12 PFAM
Pfam:TSP_3 763 786 2.1e-5 PFAM
Pfam:TSP_3 787 822 3.3e-13 PFAM
Pfam:TSP_3 822 845 1.1e-6 PFAM
Pfam:TSP_3 846 883 2e-15 PFAM
Pfam:TSP_3 884 919 8.3e-13 PFAM
Pfam:TSP_3 920 954 4.9e-10 PFAM
Pfam:TSP_C 973 1170 1.4e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148587
Meta Mutation Damage Score 0.0932 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,728 Y199* probably null Het
Adhfe1 A T 1: 9,566,804 I394F probably benign Het
Arhgap26 G T 18: 39,246,840 R485L probably damaging Het
Atat1 T A 17: 35,901,575 N231I probably damaging Het
B4galnt2 T C 11: 95,869,274 N309S probably benign Het
Bank1 A T 3: 136,066,373 F499I probably damaging Het
Bcl9l A G 9: 44,505,068 D146G possibly damaging Het
Bglap3 A T 3: 88,376,364 probably benign Het
Bscl2 C A 19: 8,847,980 T376K probably benign Het
C87499 T C 4: 88,629,195 T80A probably damaging Het
Cercam A T 2: 29,871,021 probably null Het
Clec4f C T 6: 83,656,030 M1I probably null Het
Clec4n A T 6: 123,232,107 I14F probably benign Het
Cmya5 T C 13: 93,090,585 E2665G probably damaging Het
Cog4 T A 8: 110,852,283 probably null Het
Cubn A G 2: 13,348,045 F1961L probably benign Het
Cyp4a29 A T 4: 115,246,999 H88L probably benign Het
Dhdh A G 7: 45,479,106 L216P probably damaging Het
Dpp6 T C 5: 27,666,511 F544S probably damaging Het
Dthd1 C T 5: 62,888,206 T771I probably benign Het
Dusp27 A T 1: 166,127,106 V25E probably damaging Het
Emc10 A G 7: 44,493,188 probably null Het
Fam198a C T 9: 121,965,718 R313W probably damaging Het
Fgg A T 3: 83,012,765 T284S probably benign Het
Gm3002 T A 14: 3,824,737 N24K probably damaging Het
Gm8674 G A 13: 49,901,998 noncoding transcript Het
Gpr63 G A 4: 25,008,368 W364* probably null Het
Hcn4 C G 9: 58,859,828 P891A unknown Het
Hcrtr1 A T 4: 130,130,999 F365I possibly damaging Het
Hmcn2 A G 2: 31,354,164 probably null Het
Hoxc5 T A 15: 103,015,354 L194H probably damaging Het
Ifna11 A G 4: 88,820,050 N31S probably null Het
Ikbke GCC G 1: 131,275,267 probably null Het
Iqgap2 A T 13: 95,630,006 D1496E probably benign Het
Kif28 G T 1: 179,708,442 Q556K probably damaging Het
Klhl42 C T 6: 147,108,004 T447I possibly damaging Het
Lrp1b A C 2: 41,788,974 D35E probably damaging Het
Lsm14b A G 2: 180,033,899 probably benign Het
Map3k1 T C 13: 111,772,738 E226G probably damaging Het
Map3k14 T A 11: 103,239,531 N187Y probably benign Het
Mcm6 A T 1: 128,335,849 V645E probably damaging Het
Mdh1b G T 1: 63,719,863 P190Q probably damaging Het
Meiob T G 17: 24,818,379 L77R probably damaging Het
Mkl1 C A 15: 81,045,275 probably benign Het
Mrgpra3 A T 7: 47,589,519 F220I probably benign Het
Mtor T A 4: 148,491,360 S1324T possibly damaging Het
Myot T A 18: 44,354,928 D437E possibly damaging Het
Ncoa6 G T 2: 155,421,332 T394K possibly damaging Het
Nf1 T A 11: 79,565,553 probably null Het
Nup210 T A 6: 91,036,469 T1190S possibly damaging Het
Odf1 T A 15: 38,226,408 I184N probably damaging Het
Olfr178 G T 16: 58,889,594 Q209K possibly damaging Het
Olfr270 T C 4: 52,970,960 V113A possibly damaging Het
Olfr353 A G 2: 36,890,707 I47T probably damaging Het
Olfr959 C T 9: 39,572,758 C167Y probably damaging Het
Padi1 A G 4: 140,845,590 V21A probably benign Het
Pdzrn3 C T 6: 101,151,590 R705H probably damaging Het
Pik3cb T C 9: 99,105,632 I18V probably benign Het
Pmpca T C 2: 26,390,308 S117P probably damaging Het
Poteg T A 8: 27,494,981 probably benign Het
Rab30 G A 7: 92,829,563 R72H probably damaging Het
Ramp2 T A 11: 101,247,557 probably null Het
Rbks G A 5: 31,624,532 T308I probably damaging Het
Rnf112 A G 11: 61,452,926 probably benign Het
Rnf38 G A 4: 44,152,460 P3S probably damaging Het
Sec16a A G 2: 26,412,871 S2344P probably benign Het
Slc16a8 C T 15: 79,252,884 V109M possibly damaging Het
Slc28a1 A T 7: 81,142,009 T308S possibly damaging Het
Slc39a3 T C 10: 81,031,619 T98A possibly damaging Het
Smarcc2 T C 10: 128,483,180 F731L probably damaging Het
Smc4 A G 3: 69,018,239 probably benign Het
Sparcl1 T G 5: 104,092,910 D216A probably damaging Het
Speg G A 1: 75,387,869 R192H probably damaging Het
Sspo T C 6: 48,464,605 L1892P probably damaging Het
Tacc2 A G 7: 130,623,948 N807D probably damaging Het
Teddm1a A T 1: 153,892,233 K148* probably null Het
Tex15 T A 8: 33,574,470 D1309E probably benign Het
Ticrr G A 7: 79,660,410 R24Q probably damaging Het
Tigd4 A G 3: 84,595,153 E459G probably benign Het
Tln2 C A 9: 67,355,125 A615S probably damaging Het
Tmprss5 T C 9: 49,115,517 V410A probably damaging Het
Tnrc6a G T 7: 123,189,872 W1638L probably damaging Het
Tpr A G 1: 150,410,059 D424G probably damaging Het
Trim34a A T 7: 104,261,064 K358* probably null Het
Tssk5 T A 15: 76,374,656 D10V possibly damaging Het
Usp35 A C 7: 97,313,575 L470R probably damaging Het
Usp42 T C 5: 143,715,364 D968G possibly damaging Het
Utrn A G 10: 12,455,420 V2924A probably damaging Het
Wdtc1 C A 4: 133,294,343 A627S probably damaging Het
Xrra1 A G 7: 99,906,523 T366A probably damaging Het
Zfp712 T A 13: 67,040,709 K585* probably null Het
Zfp97 T A 17: 17,145,131 N297K probably damaging Het
Zfp97 G T 17: 17,144,676 E146* probably null Het
Other mutations in Thbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Thbs1 APN 2 118122973 missense probably damaging 1.00
IGL00920:Thbs1 APN 2 118113201 missense probably damaging 0.99
IGL01295:Thbs1 APN 2 118118327 missense possibly damaging 0.88
IGL01649:Thbs1 APN 2 118114982 missense probably benign
IGL02077:Thbs1 APN 2 118113110 missense probably benign 0.00
IGL02251:Thbs1 APN 2 118113518 missense probably benign 0.00
IGL02263:Thbs1 APN 2 118119880 missense probably benign 0.06
IGL02392:Thbs1 APN 2 118114660 missense probably benign
IGL02393:Thbs1 APN 2 118123099 missense possibly damaging 0.87
IGL02411:Thbs1 APN 2 118114970 missense probably benign
IGL02659:Thbs1 APN 2 118114792 missense probably benign 0.29
Stark UTSW 2 118121237 critical splice donor site probably null
R0014:Thbs1 UTSW 2 118113350 missense possibly damaging 0.51
R0042:Thbs1 UTSW 2 118122877 missense probably damaging 1.00
R0064:Thbs1 UTSW 2 118123914 critical splice acceptor site probably null
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0316:Thbs1 UTSW 2 118117574 missense probably damaging 1.00
R0393:Thbs1 UTSW 2 118112991 missense possibly damaging 0.69
R0678:Thbs1 UTSW 2 118122906 missense probably damaging 1.00
R1037:Thbs1 UTSW 2 118123051 missense probably damaging 1.00
R1440:Thbs1 UTSW 2 118114355 missense probably damaging 1.00
R1454:Thbs1 UTSW 2 118122672 missense probably damaging 1.00
R1571:Thbs1 UTSW 2 118119197 missense probably damaging 0.99
R1702:Thbs1 UTSW 2 118113442 missense probably benign
R2035:Thbs1 UTSW 2 118118340 critical splice donor site probably null
R2068:Thbs1 UTSW 2 118123537 nonsense probably null
R2171:Thbs1 UTSW 2 118122579 missense probably damaging 1.00
R2844:Thbs1 UTSW 2 118117628 missense probably benign 0.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R3620:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3621:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3726:Thbs1 UTSW 2 118114710 missense probably benign 0.02
R4499:Thbs1 UTSW 2 118119950 missense possibly damaging 0.82
R4524:Thbs1 UTSW 2 118122979 missense probably damaging 1.00
R4576:Thbs1 UTSW 2 118119416 missense probably damaging 0.97
R4596:Thbs1 UTSW 2 118114755 missense possibly damaging 0.80
R4646:Thbs1 UTSW 2 118118329 missense probably benign 0.15
R4783:Thbs1 UTSW 2 118114792 missense probably benign 0.04
R4836:Thbs1 UTSW 2 118115018 missense possibly damaging 0.91
R4943:Thbs1 UTSW 2 118113449 missense probably damaging 1.00
R5014:Thbs1 UTSW 2 118120037 critical splice donor site probably null
R5062:Thbs1 UTSW 2 118121237 critical splice donor site probably null
R5363:Thbs1 UTSW 2 118122666 missense probably damaging 1.00
R5420:Thbs1 UTSW 2 118113155 missense possibly damaging 0.83
R5432:Thbs1 UTSW 2 118114683 missense probably benign 0.25
R5788:Thbs1 UTSW 2 118122508 missense probably damaging 1.00
R6221:Thbs1 UTSW 2 118119997 missense probably damaging 1.00
R6327:Thbs1 UTSW 2 118112656 missense unknown
R6466:Thbs1 UTSW 2 118119847 missense probably damaging 1.00
R6480:Thbs1 UTSW 2 118119117 missense probably damaging 1.00
R6794:Thbs1 UTSW 2 118120038 splice site probably null
R6983:Thbs1 UTSW 2 118119952 missense probably damaging 1.00
X0019:Thbs1 UTSW 2 118112982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCTTTTATAACCCAGAACCCG -3'
(R):5'- TCTTCCGTCTGAAAGGGGAG -3'

Sequencing Primer
(F):5'- GGGATCAGCTGTTGAAACCTTGAATC -3'
(R):5'- GAAGGCTCATGAGTGTCCAG -3'
Posted On2016-04-27