Incidental Mutation 'R4967:Bank1'
ID384086
Institutional Source Beutler Lab
Gene Symbol Bank1
Ensembl Gene ENSMUSG00000037922
Gene NameB cell scaffold protein with ankyrin repeats 1
SynonymsA530094C12Rik
MMRRC Submission 042563-MU
Accession Numbers

Genbank: NM_001033350.2

Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R4967 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location136053363-136326066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136066373 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 499 (F499I)
Ref Sequence ENSEMBL: ENSMUSP00000142996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041577] [ENSMUST00000196159] [ENSMUST00000198206]
Predicted Effect probably damaging
Transcript: ENSMUST00000041577
AA Change: F700I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035484
Gene: ENSMUSG00000037922
AA Change: F700I

DomainStartEndE-ValueType
DBB 197 327 1.24e-62 SMART
Blast:ANK 341 371 7e-12 BLAST
SCOP:d1awcb_ 344 398 2e-4 SMART
Blast:ANK 377 407 2e-6 BLAST
coiled coil region 465 486 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
coiled coil region 560 583 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196159
AA Change: F567I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142366
Gene: ENSMUSG00000037922
AA Change: F567I

DomainStartEndE-ValueType
DBB 64 194 1.24e-62 SMART
Blast:ANK 208 238 6e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 3e-6 BLAST
coiled coil region 332 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 427 450 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198206
AA Change: F499I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142996
Gene: ENSMUSG00000037922
AA Change: F499I

DomainStartEndE-ValueType
DBB 64 194 5.9e-67 SMART
Blast:ANK 208 238 5e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 2e-6 BLAST
low complexity region 300 313 N/A INTRINSIC
coiled coil region 359 382 N/A INTRINSIC
low complexity region 408 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198354
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell-specific scaffold protein that functions in B-cell receptor-induced calcium mobilization from intracellular stores. This protein can also promote Lyn-mediated tyrosine phosphorylation of inositol 1,4,5-trisphosphate receptors. Polymorphisms in this gene are associated with susceptibility to systemic lupus erythematosus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased germinal center formation and IgM production in response to T-dependent antigens, and show enhanced CD40-mediated B cell proliferative and survival responses. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,728 Y199* probably null Het
Adhfe1 A T 1: 9,566,804 I394F probably benign Het
Arhgap26 G T 18: 39,246,840 R485L probably damaging Het
Atat1 T A 17: 35,901,575 N231I probably damaging Het
B4galnt2 T C 11: 95,869,274 N309S probably benign Het
Bcl9l A G 9: 44,505,068 D146G possibly damaging Het
Bglap3 A T 3: 88,376,364 probably benign Het
Bscl2 C A 19: 8,847,980 T376K probably benign Het
C87499 T C 4: 88,629,195 T80A probably damaging Het
Cercam A T 2: 29,871,021 probably null Het
Clec4f C T 6: 83,656,030 M1I probably null Het
Clec4n A T 6: 123,232,107 I14F probably benign Het
Cmya5 T C 13: 93,090,585 E2665G probably damaging Het
Cog4 T A 8: 110,852,283 probably null Het
Cubn A G 2: 13,348,045 F1961L probably benign Het
Cyp4a29 A T 4: 115,246,999 H88L probably benign Het
Dhdh A G 7: 45,479,106 L216P probably damaging Het
Dpp6 T C 5: 27,666,511 F544S probably damaging Het
Dthd1 C T 5: 62,888,206 T771I probably benign Het
Dusp27 A T 1: 166,127,106 V25E probably damaging Het
Emc10 A G 7: 44,493,188 probably null Het
Fam198a C T 9: 121,965,718 R313W probably damaging Het
Fgg A T 3: 83,012,765 T284S probably benign Het
Gm3002 T A 14: 3,824,737 N24K probably damaging Het
Gm8674 G A 13: 49,901,998 noncoding transcript Het
Gpr63 G A 4: 25,008,368 W364* probably null Het
Hcn4 C G 9: 58,859,828 P891A unknown Het
Hcrtr1 A T 4: 130,130,999 F365I possibly damaging Het
Hmcn2 A G 2: 31,354,164 probably null Het
Hoxc5 T A 15: 103,015,354 L194H probably damaging Het
Ifna11 A G 4: 88,820,050 N31S probably null Het
Ikbke GCC G 1: 131,275,267 probably null Het
Iqgap2 A T 13: 95,630,006 D1496E probably benign Het
Kif28 G T 1: 179,708,442 Q556K probably damaging Het
Klhl42 C T 6: 147,108,004 T447I possibly damaging Het
Lrp1b A C 2: 41,788,974 D35E probably damaging Het
Lsm14b A G 2: 180,033,899 probably benign Het
Map3k1 T C 13: 111,772,738 E226G probably damaging Het
Map3k14 T A 11: 103,239,531 N187Y probably benign Het
Mcm6 A T 1: 128,335,849 V645E probably damaging Het
Mdh1b G T 1: 63,719,863 P190Q probably damaging Het
Meiob T G 17: 24,818,379 L77R probably damaging Het
Mkl1 C A 15: 81,045,275 probably benign Het
Mrgpra3 A T 7: 47,589,519 F220I probably benign Het
Mtor T A 4: 148,491,360 S1324T possibly damaging Het
Myot T A 18: 44,354,928 D437E possibly damaging Het
Ncoa6 G T 2: 155,421,332 T394K possibly damaging Het
Nf1 T A 11: 79,565,553 probably null Het
Nup210 T A 6: 91,036,469 T1190S possibly damaging Het
Odf1 T A 15: 38,226,408 I184N probably damaging Het
Olfr178 G T 16: 58,889,594 Q209K possibly damaging Het
Olfr270 T C 4: 52,970,960 V113A possibly damaging Het
Olfr353 A G 2: 36,890,707 I47T probably damaging Het
Olfr959 C T 9: 39,572,758 C167Y probably damaging Het
Padi1 A G 4: 140,845,590 V21A probably benign Het
Pdzrn3 C T 6: 101,151,590 R705H probably damaging Het
Pik3cb T C 9: 99,105,632 I18V probably benign Het
Pmpca T C 2: 26,390,308 S117P probably damaging Het
Poteg T A 8: 27,494,981 probably benign Het
Rab30 G A 7: 92,829,563 R72H probably damaging Het
Ramp2 T A 11: 101,247,557 probably null Het
Rbks G A 5: 31,624,532 T308I probably damaging Het
Rnf112 A G 11: 61,452,926 probably benign Het
Rnf38 G A 4: 44,152,460 P3S probably damaging Het
Sec16a A G 2: 26,412,871 S2344P probably benign Het
Slc16a8 C T 15: 79,252,884 V109M possibly damaging Het
Slc28a1 A T 7: 81,142,009 T308S possibly damaging Het
Slc39a3 T C 10: 81,031,619 T98A possibly damaging Het
Smarcc2 T C 10: 128,483,180 F731L probably damaging Het
Smc4 A G 3: 69,018,239 probably benign Het
Sparcl1 T G 5: 104,092,910 D216A probably damaging Het
Speg G A 1: 75,387,869 R192H probably damaging Het
Sspo T C 6: 48,464,605 L1892P probably damaging Het
Tacc2 A G 7: 130,623,948 N807D probably damaging Het
Teddm1a A T 1: 153,892,233 K148* probably null Het
Tex15 T A 8: 33,574,470 D1309E probably benign Het
Thbs1 A T 2: 118,114,778 E277D probably benign Het
Ticrr G A 7: 79,660,410 R24Q probably damaging Het
Tigd4 A G 3: 84,595,153 E459G probably benign Het
Tln2 C A 9: 67,355,125 A615S probably damaging Het
Tmprss5 T C 9: 49,115,517 V410A probably damaging Het
Tnrc6a G T 7: 123,189,872 W1638L probably damaging Het
Tpr A G 1: 150,410,059 D424G probably damaging Het
Trim34a A T 7: 104,261,064 K358* probably null Het
Tssk5 T A 15: 76,374,656 D10V possibly damaging Het
Usp35 A C 7: 97,313,575 L470R probably damaging Het
Usp42 T C 5: 143,715,364 D968G possibly damaging Het
Utrn A G 10: 12,455,420 V2924A probably damaging Het
Wdtc1 C A 4: 133,294,343 A627S probably damaging Het
Xrra1 A G 7: 99,906,523 T366A probably damaging Het
Zfp712 T A 13: 67,040,709 K585* probably null Het
Zfp97 T A 17: 17,145,131 N297K probably damaging Het
Zfp97 G T 17: 17,144,676 E146* probably null Het
Other mutations in Bank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Bank1 APN 3 136247634 missense probably damaging 0.99
IGL03088:Bank1 APN 3 136093362 missense probably damaging 0.98
IGL03190:Bank1 APN 3 136100424 missense probably damaging 1.00
I2289:Bank1 UTSW 3 136054418 missense probably damaging 1.00
R0193:Bank1 UTSW 3 136066518 splice site probably benign
R0423:Bank1 UTSW 3 136284017 missense possibly damaging 0.68
R0518:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0521:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0587:Bank1 UTSW 3 136214037 splice site probably benign
R0628:Bank1 UTSW 3 136066390 missense probably damaging 1.00
R0723:Bank1 UTSW 3 136054403 splice site probably null
R0811:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R0812:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R1101:Bank1 UTSW 3 136283864 missense probably benign 0.08
R1446:Bank1 UTSW 3 136064143 missense probably damaging 1.00
R1564:Bank1 UTSW 3 136213841 nonsense probably null
R1636:Bank1 UTSW 3 136083226 missense probably damaging 1.00
R1667:Bank1 UTSW 3 136093296 missense probably damaging 1.00
R1751:Bank1 UTSW 3 136234614 missense probably benign 0.00
R1751:Bank1 UTSW 3 136254937 missense probably benign 0.00
R2023:Bank1 UTSW 3 136325918 missense probably benign 0.02
R2851:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R2852:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R3411:Bank1 UTSW 3 136247773 splice site probably benign
R4422:Bank1 UTSW 3 136083211 missense probably damaging 0.99
R4499:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4693:Bank1 UTSW 3 136247676 missense probably damaging 0.99
R4744:Bank1 UTSW 3 136247689 missense probably benign 0.12
R4791:Bank1 UTSW 3 136254929 missense probably benign 0.00
R4911:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4979:Bank1 UTSW 3 136254901 missense probably damaging 0.99
R5119:Bank1 UTSW 3 136234682 missense possibly damaging 0.67
R5284:Bank1 UTSW 3 136064154 missense probably damaging 1.00
R5547:Bank1 UTSW 3 136066349 missense probably damaging 0.99
R5610:Bank1 UTSW 3 136066387 missense probably damaging 1.00
R6012:Bank1 UTSW 3 136213837 missense probably benign 0.44
R6087:Bank1 UTSW 3 136066429 missense probably damaging 1.00
R6753:Bank1 UTSW 3 136093308 missense probably damaging 1.00
R6764:Bank1 UTSW 3 136242940 missense probably damaging 0.97
R6861:Bank1 UTSW 3 136255003 missense probably benign 0.33
V1662:Bank1 UTSW 3 136054418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCAGTGCAGACTTCGG -3'
(R):5'- GTCCCAGTAGTTCGAATGTAAATTTCC -3'

Sequencing Primer
(F):5'- CCAGCTGATTGTTGCAAACATC -3'
(R):5'- TACTGGGCAGGAAGAACT -3'
Posted On2016-04-27