Incidental Mutation 'R4967:Mtor'
ID384096
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Namemechanistic target of rapamycin kinase
SynonymsRAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission 042563-MU
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4967 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148448611-148557683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148491360 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1324 (S1324T)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030840] [ENSMUST00000103221]
Predicted Effect probably benign
Transcript: ENSMUST00000030840
SMART Domains Protein: ENSMUSP00000030840
Gene: ENSMUSG00000028989

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
coiled coil region 36 110 N/A INTRINSIC
FBG 117 333 7.61e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103221
AA Change: S1324T

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: S1324T

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (102/102)
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,728 Y199* probably null Het
Adhfe1 A T 1: 9,566,804 I394F probably benign Het
Arhgap26 G T 18: 39,246,840 R485L probably damaging Het
Atat1 T A 17: 35,901,575 N231I probably damaging Het
B4galnt2 T C 11: 95,869,274 N309S probably benign Het
Bank1 A T 3: 136,066,373 F499I probably damaging Het
Bcl9l A G 9: 44,505,068 D146G possibly damaging Het
Bglap3 A T 3: 88,376,364 probably benign Het
Bscl2 C A 19: 8,847,980 T376K probably benign Het
C87499 T C 4: 88,629,195 T80A probably damaging Het
Cercam A T 2: 29,871,021 probably null Het
Clec4f C T 6: 83,656,030 M1I probably null Het
Clec4n A T 6: 123,232,107 I14F probably benign Het
Cmya5 T C 13: 93,090,585 E2665G probably damaging Het
Cog4 T A 8: 110,852,283 probably null Het
Cubn A G 2: 13,348,045 F1961L probably benign Het
Cyp4a29 A T 4: 115,246,999 H88L probably benign Het
Dhdh A G 7: 45,479,106 L216P probably damaging Het
Dpp6 T C 5: 27,666,511 F544S probably damaging Het
Dthd1 C T 5: 62,888,206 T771I probably benign Het
Dusp27 A T 1: 166,127,106 V25E probably damaging Het
Emc10 A G 7: 44,493,188 probably null Het
Fam198a C T 9: 121,965,718 R313W probably damaging Het
Fgg A T 3: 83,012,765 T284S probably benign Het
Gm3002 T A 14: 3,824,737 N24K probably damaging Het
Gm8674 G A 13: 49,901,998 noncoding transcript Het
Gpr63 G A 4: 25,008,368 W364* probably null Het
Hcn4 C G 9: 58,859,828 P891A unknown Het
Hcrtr1 A T 4: 130,130,999 F365I possibly damaging Het
Hmcn2 A G 2: 31,354,164 probably null Het
Hoxc5 T A 15: 103,015,354 L194H probably damaging Het
Ifna11 A G 4: 88,820,050 N31S probably null Het
Ikbke GCC G 1: 131,275,267 probably null Het
Iqgap2 A T 13: 95,630,006 D1496E probably benign Het
Kif28 G T 1: 179,708,442 Q556K probably damaging Het
Klhl42 C T 6: 147,108,004 T447I possibly damaging Het
Lrp1b A C 2: 41,788,974 D35E probably damaging Het
Lsm14b A G 2: 180,033,899 probably benign Het
Map3k1 T C 13: 111,772,738 E226G probably damaging Het
Map3k14 T A 11: 103,239,531 N187Y probably benign Het
Mcm6 A T 1: 128,335,849 V645E probably damaging Het
Mdh1b G T 1: 63,719,863 P190Q probably damaging Het
Meiob T G 17: 24,818,379 L77R probably damaging Het
Mkl1 C A 15: 81,045,275 probably benign Het
Mrgpra3 A T 7: 47,589,519 F220I probably benign Het
Myot T A 18: 44,354,928 D437E possibly damaging Het
Ncoa6 G T 2: 155,421,332 T394K possibly damaging Het
Nf1 T A 11: 79,565,553 probably null Het
Nup210 T A 6: 91,036,469 T1190S possibly damaging Het
Odf1 T A 15: 38,226,408 I184N probably damaging Het
Olfr178 G T 16: 58,889,594 Q209K possibly damaging Het
Olfr270 T C 4: 52,970,960 V113A possibly damaging Het
Olfr353 A G 2: 36,890,707 I47T probably damaging Het
Olfr959 C T 9: 39,572,758 C167Y probably damaging Het
Padi1 A G 4: 140,845,590 V21A probably benign Het
Pdzrn3 C T 6: 101,151,590 R705H probably damaging Het
Pik3cb T C 9: 99,105,632 I18V probably benign Het
Pmpca T C 2: 26,390,308 S117P probably damaging Het
Poteg T A 8: 27,494,981 probably benign Het
Rab30 G A 7: 92,829,563 R72H probably damaging Het
Ramp2 T A 11: 101,247,557 probably null Het
Rbks G A 5: 31,624,532 T308I probably damaging Het
Rnf112 A G 11: 61,452,926 probably benign Het
Rnf38 G A 4: 44,152,460 P3S probably damaging Het
Sec16a A G 2: 26,412,871 S2344P probably benign Het
Slc16a8 C T 15: 79,252,884 V109M possibly damaging Het
Slc28a1 A T 7: 81,142,009 T308S possibly damaging Het
Slc39a3 T C 10: 81,031,619 T98A possibly damaging Het
Smarcc2 T C 10: 128,483,180 F731L probably damaging Het
Smc4 A G 3: 69,018,239 probably benign Het
Sparcl1 T G 5: 104,092,910 D216A probably damaging Het
Speg G A 1: 75,387,869 R192H probably damaging Het
Sspo T C 6: 48,464,605 L1892P probably damaging Het
Tacc2 A G 7: 130,623,948 N807D probably damaging Het
Teddm1a A T 1: 153,892,233 K148* probably null Het
Tex15 T A 8: 33,574,470 D1309E probably benign Het
Thbs1 A T 2: 118,114,778 E277D probably benign Het
Ticrr G A 7: 79,660,410 R24Q probably damaging Het
Tigd4 A G 3: 84,595,153 E459G probably benign Het
Tln2 C A 9: 67,355,125 A615S probably damaging Het
Tmprss5 T C 9: 49,115,517 V410A probably damaging Het
Tnrc6a G T 7: 123,189,872 W1638L probably damaging Het
Tpr A G 1: 150,410,059 D424G probably damaging Het
Trim34a A T 7: 104,261,064 K358* probably null Het
Tssk5 T A 15: 76,374,656 D10V possibly damaging Het
Usp35 A C 7: 97,313,575 L470R probably damaging Het
Usp42 T C 5: 143,715,364 D968G possibly damaging Het
Utrn A G 10: 12,455,420 V2924A probably damaging Het
Wdtc1 C A 4: 133,294,343 A627S probably damaging Het
Xrra1 A G 7: 99,906,523 T366A probably damaging Het
Zfp712 T A 13: 67,040,709 K585* probably null Het
Zfp97 T A 17: 17,145,131 N297K probably damaging Het
Zfp97 G T 17: 17,144,676 E146* probably null Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 unclassified probably null
motor UTSW 4 148491360 missense possibly damaging 0.76
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 unclassified probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTCCTCTGCCTCTTGAGGAAGG -3'
(R):5'- TACAGTAGCTGGGCACACAC -3'

Sequencing Primer
(F):5'- GGTTTAGGTACCATCCAACAGGTTC -3'
(R):5'- GCCAGCCAGTTTCCTATCACTG -3'
Posted On2016-04-27