Incidental Mutation 'R0345:Adgrb1'
ID38410
Institutional Source Beutler Lab
Gene Symbol Adgrb1
Ensembl Gene ENSMUSG00000034730
Gene Nameadhesion G protein-coupled receptor B1
SynonymsBai1, B830018M07Rik
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0345 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74516195-74589465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74543349 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 641 (N641S)
Ref Sequence ENSEMBL: ENSMUSP00000046097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]
Predicted Effect probably damaging
Transcript: ENSMUST00000042035
AA Change: N641S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: N641S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 4.69e-10 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 3.5e-9 SMART
TSP1 412 462 3.16e-16 SMART
TSP1 470 520 7.15e-15 SMART
TSP1 525 575 3.11e-15 SMART
HormR 577 643 2.55e-20 SMART
Pfam:GAIN 656 859 1e-46 PFAM
GPS 880 938 1.46e-18 SMART
Pfam:7tm_2 944 1180 3.3e-66 PFAM
SCOP:d1jvr__ 1396 1432 5e-4 SMART
low complexity region 1441 1455 N/A INTRINSIC
low complexity region 1545 1556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186360
AA Change: N641S

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: N641S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 1.7e-11 SMART
TSP1 412 462 1.5e-18 SMART
TSP1 470 520 3.4e-17 SMART
TSP1 525 575 1.5e-17 SMART
HormR 577 643 1.6e-22 SMART
Pfam:DUF3497 653 874 1.2e-44 PFAM
GPS 880 938 8.9e-21 SMART
Pfam:7tm_2 944 1106 9.6e-43 PFAM
low complexity region 1113 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187485
SMART Domains Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189200
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Ap2a2 T A 7: 141,631,293 M914K probably damaging Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Chrnb4 A G 9: 55,035,594 V132A probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Cyp2d37-ps A T 15: 82,689,774 noncoding transcript Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Llgl2 A G 11: 115,849,992 probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myo5c A G 9: 75,297,419 E1518G probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr670 T A 7: 104,960,181 M184L probably damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Olfr992 T C 2: 85,400,341 Q64R possibly damaging Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sntb2 T C 8: 107,001,538 S373P probably damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stap2 A G 17: 56,000,097 V217A probably damaging Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Synm C T 7: 67,735,821 V256I probably benign Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Zyg11b A G 4: 108,266,407 I121T probably damaging Het
Other mutations in Adgrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Adgrb1 APN 15 74586835 missense probably damaging 1.00
IGL01748:Adgrb1 APN 15 74548357 splice site probably benign
IGL01874:Adgrb1 APN 15 74541574 missense possibly damaging 0.95
IGL02040:Adgrb1 APN 15 74541575 missense possibly damaging 0.91
IGL02138:Adgrb1 APN 15 74529782 missense probably damaging 1.00
IGL02149:Adgrb1 APN 15 74540477 missense probably damaging 1.00
IGL02320:Adgrb1 APN 15 74574112 missense probably damaging 1.00
IGL02556:Adgrb1 APN 15 74586805 missense probably damaging 0.99
IGL02637:Adgrb1 APN 15 74588294 splice site probably benign
IGL02678:Adgrb1 APN 15 74538328 missense probably damaging 0.99
IGL02792:Adgrb1 APN 15 74547622 missense probably damaging 0.98
bunting UTSW 15 74543701 missense probably null 0.94
R0193:Adgrb1 UTSW 15 74572156 missense probably damaging 1.00
R0208:Adgrb1 UTSW 15 74586807 missense probably benign
R0267:Adgrb1 UTSW 15 74529389 missense probably damaging 1.00
R0336:Adgrb1 UTSW 15 74587149 missense probably benign 0.06
R0533:Adgrb1 UTSW 15 74541559 missense probably damaging 1.00
R0635:Adgrb1 UTSW 15 74540892 missense possibly damaging 0.88
R0729:Adgrb1 UTSW 15 74548549 missense probably damaging 1.00
R0792:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1122:Adgrb1 UTSW 15 74547685 missense probably damaging 0.99
R1295:Adgrb1 UTSW 15 74550039 missense probably damaging 1.00
R1522:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1696:Adgrb1 UTSW 15 74588107 missense probably damaging 1.00
R1707:Adgrb1 UTSW 15 74529343 missense probably damaging 0.99
R1750:Adgrb1 UTSW 15 74541827 missense probably benign 0.23
R1804:Adgrb1 UTSW 15 74529540 missense probably damaging 1.00
R1829:Adgrb1 UTSW 15 74580586 nonsense probably null
R1895:Adgrb1 UTSW 15 74540465 missense probably damaging 1.00
R1970:Adgrb1 UTSW 15 74539877 splice site probably benign
R2114:Adgrb1 UTSW 15 74540562 critical splice donor site probably null
R2133:Adgrb1 UTSW 15 74529908 missense probably damaging 1.00
R2210:Adgrb1 UTSW 15 74547704 missense probably damaging 1.00
R3701:Adgrb1 UTSW 15 74545015 missense probably damaging 0.99
R3770:Adgrb1 UTSW 15 74588308 missense probably damaging 1.00
R3980:Adgrb1 UTSW 15 74582943 missense probably damaging 1.00
R4355:Adgrb1 UTSW 15 74543662 missense probably damaging 1.00
R4412:Adgrb1 UTSW 15 74577453 unclassified probably benign
R4634:Adgrb1 UTSW 15 74584429 utr 3 prime probably benign
R4683:Adgrb1 UTSW 15 74588114 missense probably damaging 1.00
R4742:Adgrb1 UTSW 15 74529479 nonsense probably null
R4760:Adgrb1 UTSW 15 74571463 missense probably damaging 1.00
R4794:Adgrb1 UTSW 15 74588129 missense probably damaging 1.00
R4880:Adgrb1 UTSW 15 74587022 missense possibly damaging 0.85
R4885:Adgrb1 UTSW 15 74572162 missense probably benign 0.04
R5092:Adgrb1 UTSW 15 74529815 missense probably benign 0.39
R5198:Adgrb1 UTSW 15 74543701 missense probably null 0.94
R5225:Adgrb1 UTSW 15 74577499 unclassified probably benign
R5421:Adgrb1 UTSW 15 74550027 missense probably damaging 1.00
R5764:Adgrb1 UTSW 15 74541574 missense possibly damaging 0.95
R5914:Adgrb1 UTSW 15 74538370 missense possibly damaging 0.54
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6066:Adgrb1 UTSW 15 74540459 missense probably damaging 0.99
R6423:Adgrb1 UTSW 15 74588143 critical splice donor site probably null
R6811:Adgrb1 UTSW 15 74529361 missense probably damaging 1.00
R6945:Adgrb1 UTSW 15 74550024 missense probably damaging 0.99
R7012:Adgrb1 UTSW 15 74529901 missense probably damaging 0.97
R7015:Adgrb1 UTSW 15 74574110 missense probably damaging 1.00
R7061:Adgrb1 UTSW 15 74569881 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAAGCCAGCATGGCCTGTTTC -3'
(R):5'- TGAGCCTTTGCCAGGTGTTCTC -3'

Sequencing Primer
(F):5'- CAAACAGAGCACTTCTGCCTG -3'
(R):5'- GCCAGGTGTTCTCGGGTC -3'
Posted On2013-05-23