Incidental Mutation 'R4967:Nup210'
ID384104
Institutional Source Beutler Lab
Gene Symbol Nup210
Ensembl Gene ENSMUSG00000030091
Gene Namenucleoporin 210
Synonymsgp190, Pom210, gp210
MMRRC Submission 042563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4967 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91013068-91116829 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91036469 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1190 (T1190S)
Ref Sequence ENSEMBL: ENSMUSP00000032179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032179] [ENSMUST00000113509] [ENSMUST00000142951]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032179
AA Change: T1190S

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032179
Gene: ENSMUSG00000030091
AA Change: T1190S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 3e-29 BLAST
low complexity region 850 862 N/A INTRINSIC
Blast:S1 937 1022 6e-37 BLAST
BID_2 1077 1152 8.36e-6 SMART
low complexity region 1159 1168 N/A INTRINSIC
Blast:BID_2 1468 1551 3e-35 BLAST
transmembrane domain 1809 1831 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113509
AA Change: T1146S

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109137
Gene: ENSMUSG00000030091
AA Change: T1146S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 4e-29 BLAST
low complexity region 806 818 N/A INTRINSIC
Blast:S1 893 978 4e-37 BLAST
BID_2 1033 1108 8.36e-6 SMART
low complexity region 1115 1124 N/A INTRINSIC
Blast:BID_2 1424 1507 3e-35 BLAST
transmembrane domain 1765 1787 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142951
AA Change: T403S

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120098
Gene: ENSMUSG00000030091
AA Change: T403S

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
Blast:S1 150 235 3e-37 BLAST
BID_2 290 365 8.36e-6 SMART
low complexity region 372 381 N/A INTRINSIC
Blast:BID_2 681 764 1e-35 BLAST
transmembrane domain 1022 1044 N/A INTRINSIC
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a membrane-spanning glycoprotein that is a major component of the nuclear pore complex. Multiple pseudogenes related to this gene are located on chromosome 3. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,728 Y199* probably null Het
Adhfe1 A T 1: 9,566,804 I394F probably benign Het
Arhgap26 G T 18: 39,246,840 R485L probably damaging Het
Atat1 T A 17: 35,901,575 N231I probably damaging Het
B4galnt2 T C 11: 95,869,274 N309S probably benign Het
Bank1 A T 3: 136,066,373 F499I probably damaging Het
Bcl9l A G 9: 44,505,068 D146G possibly damaging Het
Bglap3 A T 3: 88,376,364 probably benign Het
Bscl2 C A 19: 8,847,980 T376K probably benign Het
C87499 T C 4: 88,629,195 T80A probably damaging Het
Cercam A T 2: 29,871,021 probably null Het
Clec4f C T 6: 83,656,030 M1I probably null Het
Clec4n A T 6: 123,232,107 I14F probably benign Het
Cmya5 T C 13: 93,090,585 E2665G probably damaging Het
Cog4 T A 8: 110,852,283 probably null Het
Cubn A G 2: 13,348,045 F1961L probably benign Het
Cyp4a29 A T 4: 115,246,999 H88L probably benign Het
Dhdh A G 7: 45,479,106 L216P probably damaging Het
Dpp6 T C 5: 27,666,511 F544S probably damaging Het
Dthd1 C T 5: 62,888,206 T771I probably benign Het
Dusp27 A T 1: 166,127,106 V25E probably damaging Het
Emc10 A G 7: 44,493,188 probably null Het
Fam198a C T 9: 121,965,718 R313W probably damaging Het
Fgg A T 3: 83,012,765 T284S probably benign Het
Gm3002 T A 14: 3,824,737 N24K probably damaging Het
Gm8674 G A 13: 49,901,998 noncoding transcript Het
Gpr63 G A 4: 25,008,368 W364* probably null Het
Hcn4 C G 9: 58,859,828 P891A unknown Het
Hcrtr1 A T 4: 130,130,999 F365I possibly damaging Het
Hmcn2 A G 2: 31,354,164 probably null Het
Hoxc5 T A 15: 103,015,354 L194H probably damaging Het
Ifna11 A G 4: 88,820,050 N31S probably null Het
Ikbke GCC G 1: 131,275,267 probably null Het
Iqgap2 A T 13: 95,630,006 D1496E probably benign Het
Kif28 G T 1: 179,708,442 Q556K probably damaging Het
Klhl42 C T 6: 147,108,004 T447I possibly damaging Het
Lrp1b A C 2: 41,788,974 D35E probably damaging Het
Lsm14b A G 2: 180,033,899 probably benign Het
Map3k1 T C 13: 111,772,738 E226G probably damaging Het
Map3k14 T A 11: 103,239,531 N187Y probably benign Het
Mcm6 A T 1: 128,335,849 V645E probably damaging Het
Mdh1b G T 1: 63,719,863 P190Q probably damaging Het
Meiob T G 17: 24,818,379 L77R probably damaging Het
Mkl1 C A 15: 81,045,275 probably benign Het
Mrgpra3 A T 7: 47,589,519 F220I probably benign Het
Mtor T A 4: 148,491,360 S1324T possibly damaging Het
Myot T A 18: 44,354,928 D437E possibly damaging Het
Ncoa6 G T 2: 155,421,332 T394K possibly damaging Het
Nf1 T A 11: 79,565,553 probably null Het
Odf1 T A 15: 38,226,408 I184N probably damaging Het
Olfr178 G T 16: 58,889,594 Q209K possibly damaging Het
Olfr270 T C 4: 52,970,960 V113A possibly damaging Het
Olfr353 A G 2: 36,890,707 I47T probably damaging Het
Olfr959 C T 9: 39,572,758 C167Y probably damaging Het
Padi1 A G 4: 140,845,590 V21A probably benign Het
Pdzrn3 C T 6: 101,151,590 R705H probably damaging Het
Pik3cb T C 9: 99,105,632 I18V probably benign Het
Pmpca T C 2: 26,390,308 S117P probably damaging Het
Poteg T A 8: 27,494,981 probably benign Het
Rab30 G A 7: 92,829,563 R72H probably damaging Het
Ramp2 T A 11: 101,247,557 probably null Het
Rbks G A 5: 31,624,532 T308I probably damaging Het
Rnf112 A G 11: 61,452,926 probably benign Het
Rnf38 G A 4: 44,152,460 P3S probably damaging Het
Sec16a A G 2: 26,412,871 S2344P probably benign Het
Slc16a8 C T 15: 79,252,884 V109M possibly damaging Het
Slc28a1 A T 7: 81,142,009 T308S possibly damaging Het
Slc39a3 T C 10: 81,031,619 T98A possibly damaging Het
Smarcc2 T C 10: 128,483,180 F731L probably damaging Het
Smc4 A G 3: 69,018,239 probably benign Het
Sparcl1 T G 5: 104,092,910 D216A probably damaging Het
Speg G A 1: 75,387,869 R192H probably damaging Het
Sspo T C 6: 48,464,605 L1892P probably damaging Het
Tacc2 A G 7: 130,623,948 N807D probably damaging Het
Teddm1a A T 1: 153,892,233 K148* probably null Het
Tex15 T A 8: 33,574,470 D1309E probably benign Het
Thbs1 A T 2: 118,114,778 E277D probably benign Het
Ticrr G A 7: 79,660,410 R24Q probably damaging Het
Tigd4 A G 3: 84,595,153 E459G probably benign Het
Tln2 C A 9: 67,355,125 A615S probably damaging Het
Tmprss5 T C 9: 49,115,517 V410A probably damaging Het
Tnrc6a G T 7: 123,189,872 W1638L probably damaging Het
Tpr A G 1: 150,410,059 D424G probably damaging Het
Trim34a A T 7: 104,261,064 K358* probably null Het
Tssk5 T A 15: 76,374,656 D10V possibly damaging Het
Usp35 A C 7: 97,313,575 L470R probably damaging Het
Usp42 T C 5: 143,715,364 D968G possibly damaging Het
Utrn A G 10: 12,455,420 V2924A probably damaging Het
Wdtc1 C A 4: 133,294,343 A627S probably damaging Het
Xrra1 A G 7: 99,906,523 T366A probably damaging Het
Zfp712 T A 13: 67,040,709 K585* probably null Het
Zfp97 T A 17: 17,145,131 N297K probably damaging Het
Zfp97 G T 17: 17,144,676 E146* probably null Het
Other mutations in Nup210
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Nup210 APN 6 91030097 missense possibly damaging 0.92
IGL01532:Nup210 APN 6 91085999 splice site probably benign
IGL01574:Nup210 APN 6 91040564 missense probably benign 0.35
IGL01621:Nup210 APN 6 91030117 missense probably damaging 1.00
IGL01976:Nup210 APN 6 91053614 missense possibly damaging 0.89
IGL02089:Nup210 APN 6 91076698 missense probably benign 0.04
IGL02291:Nup210 APN 6 91101268 missense probably damaging 1.00
IGL03013:Nup210 APN 6 91053379 missense probably benign 0.00
IGL03046:Nup210 APN 6 91018996 splice site probably benign
IGL03136:Nup210 APN 6 91028861 missense probably benign 0.32
IGL03139:Nup210 APN 6 91020239 missense probably benign 0.08
IGL03195:Nup210 APN 6 91015850 missense probably benign 0.32
IGL03344:Nup210 APN 6 91021429 missense possibly damaging 0.53
brotherhood UTSW 6 91036469 missense possibly damaging 0.81
equality UTSW 6 91021395 critical splice donor site probably null
liberty UTSW 6 91020180 missense probably benign 0.04
unity UTSW 6 91031668 nonsense probably null
IGL03134:Nup210 UTSW 6 91030190 missense probably damaging 0.99
R0100:Nup210 UTSW 6 91069193 missense probably benign 0.04
R0348:Nup210 UTSW 6 91074310 missense probably benign 0.27
R0385:Nup210 UTSW 6 91028795 missense possibly damaging 0.77
R0551:Nup210 UTSW 6 91021484 missense possibly damaging 0.85
R0606:Nup210 UTSW 6 91026929 missense possibly damaging 0.89
R1053:Nup210 UTSW 6 91028811 missense probably benign 0.41
R1301:Nup210 UTSW 6 91042347 missense possibly damaging 0.47
R1381:Nup210 UTSW 6 91075960 missense probably damaging 0.99
R1464:Nup210 UTSW 6 91053569 missense possibly damaging 0.82
R1464:Nup210 UTSW 6 91053569 missense possibly damaging 0.82
R1487:Nup210 UTSW 6 91042576 missense probably damaging 1.00
R1522:Nup210 UTSW 6 91069166 missense possibly damaging 0.85
R1529:Nup210 UTSW 6 91036376 missense probably damaging 1.00
R1531:Nup210 UTSW 6 91034841 missense probably benign 0.05
R1668:Nup210 UTSW 6 91028805 missense possibly damaging 0.89
R1694:Nup210 UTSW 6 91062803 missense probably benign 0.09
R1803:Nup210 UTSW 6 91074282 missense probably damaging 0.99
R1851:Nup210 UTSW 6 91016054 missense probably damaging 1.00
R2145:Nup210 UTSW 6 91028876 missense possibly damaging 0.81
R2196:Nup210 UTSW 6 91055244 missense probably benign 0.02
R2308:Nup210 UTSW 6 91040868 missense probably benign 0.19
R2419:Nup210 UTSW 6 91017556 splice site probably benign
R2912:Nup210 UTSW 6 91026974 missense probably damaging 1.00
R3413:Nup210 UTSW 6 91025242 missense probably benign 0.00
R3718:Nup210 UTSW 6 91020180 missense probably benign 0.04
R3753:Nup210 UTSW 6 91021395 critical splice donor site probably null
R4058:Nup210 UTSW 6 91060620 missense probably benign 0.02
R4840:Nup210 UTSW 6 91031668 nonsense probably null
R4912:Nup210 UTSW 6 91017529 missense probably benign 0.01
R4996:Nup210 UTSW 6 91053436 missense probably benign 0.16
R5074:Nup210 UTSW 6 91055327 missense probably benign 0.16
R5233:Nup210 UTSW 6 91026969 missense probably damaging 1.00
R5352:Nup210 UTSW 6 91069316 missense probably damaging 1.00
R5490:Nup210 UTSW 6 91085988 missense probably damaging 0.98
R5511:Nup210 UTSW 6 91026963 missense probably damaging 0.97
R5773:Nup210 UTSW 6 91085883 missense probably damaging 0.96
R6064:Nup210 UTSW 6 91055291 missense probably benign 0.01
R6209:Nup210 UTSW 6 91025355 missense probably benign
R6299:Nup210 UTSW 6 91074288 missense possibly damaging 0.68
R6705:Nup210 UTSW 6 91087960 missense possibly damaging 0.50
R6855:Nup210 UTSW 6 91040853 missense probably benign 0.13
R6856:Nup210 UTSW 6 91087913 nonsense probably null
R6911:Nup210 UTSW 6 91030130 missense probably damaging 0.98
R6955:Nup210 UTSW 6 91087927 missense probably damaging 1.00
X0067:Nup210 UTSW 6 91074280 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTAGACTCCTGTGCAGC -3'
(R):5'- GCATTGTGTCAAACTTCCTGATC -3'

Sequencing Primer
(F):5'- AGACTCCTGTGCAGCAATGTG -3'
(R):5'- GTGTCAAACTTCCTGATCCTCTG -3'
Posted On2016-04-27