Incidental Mutation 'R0345:Cyp2d37-ps'
ID38412
Institutional Source Beutler Lab
Gene Symbol Cyp2d37-ps
Ensembl Gene ENSMUSG00000075517
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 37, pseudogene
SynonymsGm6800
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R0345 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82688750-82690058 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 82689774 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000100380]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100380
SMART Domains Protein: ENSMUSP00000097949
Gene: ENSMUSG00000075517

DomainStartEndE-ValueType
Pfam:p450 1 82 3.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229594
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Adgrb1 A G 15: 74,543,349 N641S probably damaging Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Ap2a2 T A 7: 141,631,293 M914K probably damaging Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Chrnb4 A G 9: 55,035,594 V132A probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Llgl2 A G 11: 115,849,992 probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myo5c A G 9: 75,297,419 E1518G probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr670 T A 7: 104,960,181 M184L probably damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Olfr992 T C 2: 85,400,341 Q64R possibly damaging Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sntb2 T C 8: 107,001,538 S373P probably damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stap2 A G 17: 56,000,097 V217A probably damaging Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Synm C T 7: 67,735,821 V256I probably benign Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Zyg11b A G 4: 108,266,407 I121T probably damaging Het
Other mutations in Cyp2d37-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0360:Cyp2d37-ps UTSW 15 82690052 intron noncoding transcript
R0364:Cyp2d37-ps UTSW 15 82690052 intron noncoding transcript
R0726:Cyp2d37-ps UTSW 15 82690449 exon noncoding transcript
R2062:Cyp2d37-ps UTSW 15 82690088 exon noncoding transcript
R5308:Cyp2d37-ps UTSW 15 82689811 exon noncoding transcript
R6193:Cyp2d37-ps UTSW 15 82689813 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AGCTGGCAACACTGACTAGACACTG -3'
(R):5'- TGCTGCAACTGTGACCACCTCAAC -3'

Sequencing Primer
(F):5'- CTGACTAGACACTGGAGAGACC -3'
(R):5'- GACACTTGTAGATCCCAGCATTG -3'
Posted On2013-05-23