Incidental Mutation 'R4967:Tex15'
ID384121
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Nametestis expressed gene 15
Synonyms2210014E14Rik
MMRRC Submission 042563-MU
Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R4967 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location33516738-33585582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33574470 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1309 (D1309E)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]
Predicted Effect probably benign
Transcript: ENSMUST00000009772
AA Change: D1309E

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: D1309E

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124496
SMART Domains Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 89 251 1.6e-58 PFAM
low complexity region 536 548 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 798 810 N/A INTRINSIC
low complexity region 939 948 N/A INTRINSIC
low complexity region 987 999 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (102/102)
MGI Phenotype Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,728 Y199* probably null Het
Adhfe1 A T 1: 9,566,804 I394F probably benign Het
Arhgap26 G T 18: 39,246,840 R485L probably damaging Het
Atat1 T A 17: 35,901,575 N231I probably damaging Het
B4galnt2 T C 11: 95,869,274 N309S probably benign Het
Bank1 A T 3: 136,066,373 F499I probably damaging Het
Bcl9l A G 9: 44,505,068 D146G possibly damaging Het
Bglap3 A T 3: 88,376,364 probably benign Het
Bscl2 C A 19: 8,847,980 T376K probably benign Het
C87499 T C 4: 88,629,195 T80A probably damaging Het
Cercam A T 2: 29,871,021 probably null Het
Clec4f C T 6: 83,656,030 M1I probably null Het
Clec4n A T 6: 123,232,107 I14F probably benign Het
Cmya5 T C 13: 93,090,585 E2665G probably damaging Het
Cog4 T A 8: 110,852,283 probably null Het
Cubn A G 2: 13,348,045 F1961L probably benign Het
Cyp4a29 A T 4: 115,246,999 H88L probably benign Het
Dhdh A G 7: 45,479,106 L216P probably damaging Het
Dpp6 T C 5: 27,666,511 F544S probably damaging Het
Dthd1 C T 5: 62,888,206 T771I probably benign Het
Dusp27 A T 1: 166,127,106 V25E probably damaging Het
Emc10 A G 7: 44,493,188 probably null Het
Fam198a C T 9: 121,965,718 R313W probably damaging Het
Fgg A T 3: 83,012,765 T284S probably benign Het
Gm3002 T A 14: 3,824,737 N24K probably damaging Het
Gm8674 G A 13: 49,901,998 noncoding transcript Het
Gpr63 G A 4: 25,008,368 W364* probably null Het
Hcn4 C G 9: 58,859,828 P891A unknown Het
Hcrtr1 A T 4: 130,130,999 F365I possibly damaging Het
Hmcn2 A G 2: 31,354,164 probably null Het
Hoxc5 T A 15: 103,015,354 L194H probably damaging Het
Ifna11 A G 4: 88,820,050 N31S probably null Het
Ikbke GCC G 1: 131,275,267 probably null Het
Iqgap2 A T 13: 95,630,006 D1496E probably benign Het
Kif28 G T 1: 179,708,442 Q556K probably damaging Het
Klhl42 C T 6: 147,108,004 T447I possibly damaging Het
Lrp1b A C 2: 41,788,974 D35E probably damaging Het
Lsm14b A G 2: 180,033,899 probably benign Het
Map3k1 T C 13: 111,772,738 E226G probably damaging Het
Map3k14 T A 11: 103,239,531 N187Y probably benign Het
Mcm6 A T 1: 128,335,849 V645E probably damaging Het
Mdh1b G T 1: 63,719,863 P190Q probably damaging Het
Meiob T G 17: 24,818,379 L77R probably damaging Het
Mkl1 C A 15: 81,045,275 probably benign Het
Mrgpra3 A T 7: 47,589,519 F220I probably benign Het
Mtor T A 4: 148,491,360 S1324T possibly damaging Het
Myot T A 18: 44,354,928 D437E possibly damaging Het
Ncoa6 G T 2: 155,421,332 T394K possibly damaging Het
Nf1 T A 11: 79,565,553 probably null Het
Nup210 T A 6: 91,036,469 T1190S possibly damaging Het
Odf1 T A 15: 38,226,408 I184N probably damaging Het
Olfr178 G T 16: 58,889,594 Q209K possibly damaging Het
Olfr270 T C 4: 52,970,960 V113A possibly damaging Het
Olfr353 A G 2: 36,890,707 I47T probably damaging Het
Olfr959 C T 9: 39,572,758 C167Y probably damaging Het
Padi1 A G 4: 140,845,590 V21A probably benign Het
Pdzrn3 C T 6: 101,151,590 R705H probably damaging Het
Pik3cb T C 9: 99,105,632 I18V probably benign Het
Pmpca T C 2: 26,390,308 S117P probably damaging Het
Poteg T A 8: 27,494,981 probably benign Het
Rab30 G A 7: 92,829,563 R72H probably damaging Het
Ramp2 T A 11: 101,247,557 probably null Het
Rbks G A 5: 31,624,532 T308I probably damaging Het
Rnf112 A G 11: 61,452,926 probably benign Het
Rnf38 G A 4: 44,152,460 P3S probably damaging Het
Sec16a A G 2: 26,412,871 S2344P probably benign Het
Slc16a8 C T 15: 79,252,884 V109M possibly damaging Het
Slc28a1 A T 7: 81,142,009 T308S possibly damaging Het
Slc39a3 T C 10: 81,031,619 T98A possibly damaging Het
Smarcc2 T C 10: 128,483,180 F731L probably damaging Het
Smc4 A G 3: 69,018,239 probably benign Het
Sparcl1 T G 5: 104,092,910 D216A probably damaging Het
Speg G A 1: 75,387,869 R192H probably damaging Het
Sspo T C 6: 48,464,605 L1892P probably damaging Het
Tacc2 A G 7: 130,623,948 N807D probably damaging Het
Teddm1a A T 1: 153,892,233 K148* probably null Het
Thbs1 A T 2: 118,114,778 E277D probably benign Het
Ticrr G A 7: 79,660,410 R24Q probably damaging Het
Tigd4 A G 3: 84,595,153 E459G probably benign Het
Tln2 C A 9: 67,355,125 A615S probably damaging Het
Tmprss5 T C 9: 49,115,517 V410A probably damaging Het
Tnrc6a G T 7: 123,189,872 W1638L probably damaging Het
Tpr A G 1: 150,410,059 D424G probably damaging Het
Trim34a A T 7: 104,261,064 K358* probably null Het
Tssk5 T A 15: 76,374,656 D10V possibly damaging Het
Usp35 A C 7: 97,313,575 L470R probably damaging Het
Usp42 T C 5: 143,715,364 D968G possibly damaging Het
Utrn A G 10: 12,455,420 V2924A probably damaging Het
Wdtc1 C A 4: 133,294,343 A627S probably damaging Het
Xrra1 A G 7: 99,906,523 T366A probably damaging Het
Zfp712 T A 13: 67,040,709 K585* probably null Het
Zfp97 T A 17: 17,145,131 N297K probably damaging Het
Zfp97 G T 17: 17,144,676 E146* probably null Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 33575311 missense probably benign 0.18
IGL00705:Tex15 APN 8 33581592 missense probably damaging 1.00
IGL00820:Tex15 APN 8 33579006 splice site probably benign
IGL01288:Tex15 APN 8 33571384 missense probably benign 0.02
IGL01328:Tex15 APN 8 33571396 nonsense probably null
IGL01359:Tex15 APN 8 33581898 missense probably damaging 0.99
IGL01603:Tex15 APN 8 33573547 missense possibly damaging 0.93
IGL01861:Tex15 APN 8 33570689 missense probably damaging 1.00
IGL02052:Tex15 APN 8 33582465 missense probably benign 0.28
IGL02560:Tex15 APN 8 33581751 missense probably benign 0.00
IGL02677:Tex15 APN 8 33571080 missense probably benign 0.03
IGL02739:Tex15 APN 8 33581693 missense possibly damaging 0.68
P0005:Tex15 UTSW 8 33570868 missense probably benign 0.00
P0037:Tex15 UTSW 8 33581580 missense probably benign 0.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0595:Tex15 UTSW 8 33572617 missense probably damaging 1.00
R0646:Tex15 UTSW 8 33582326 missense possibly damaging 0.83
R0688:Tex15 UTSW 8 33573500 missense probably damaging 1.00
R0842:Tex15 UTSW 8 33571547 missense possibly damaging 0.95
R0987:Tex15 UTSW 8 33576847 missense probably damaging 1.00
R1084:Tex15 UTSW 8 33577004 missense probably benign 0.28
R1183:Tex15 UTSW 8 33574865 missense probably benign 0.35
R1186:Tex15 UTSW 8 33571633 missense probably benign 0.19
R1378:Tex15 UTSW 8 33575216 missense probably damaging 0.99
R1500:Tex15 UTSW 8 33575092 missense probably damaging 0.96
R1508:Tex15 UTSW 8 33576852 missense probably damaging 1.00
R1597:Tex15 UTSW 8 33571483 missense probably damaging 0.96
R1636:Tex15 UTSW 8 33576387 nonsense probably null
R1639:Tex15 UTSW 8 33570817 missense possibly damaging 0.94
R1809:Tex15 UTSW 8 33574234 missense probably benign
R1843:Tex15 UTSW 8 33576654 missense probably benign 0.27
R2029:Tex15 UTSW 8 33571274 missense probably damaging 0.99
R2228:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2229:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2245:Tex15 UTSW 8 33571496 missense possibly damaging 0.77
R2246:Tex15 UTSW 8 33582512 missense possibly damaging 0.49
R2880:Tex15 UTSW 8 33574907 nonsense probably null
R2881:Tex15 UTSW 8 33574907 nonsense probably null
R2882:Tex15 UTSW 8 33574907 nonsense probably null
R3001:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3002:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3020:Tex15 UTSW 8 33576670 missense probably damaging 1.00
R3084:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3085:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3701:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3702:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3752:Tex15 UTSW 8 33571415 missense probably benign
R4162:Tex15 UTSW 8 33581558 missense probably damaging 1.00
R4231:Tex15 UTSW 8 33572137 missense probably damaging 0.99
R4589:Tex15 UTSW 8 33557373 missense probably damaging 1.00
R4707:Tex15 UTSW 8 33582497 missense probably benign 0.00
R4773:Tex15 UTSW 8 33582732 missense probably benign 0.42
R5063:Tex15 UTSW 8 33582610 missense possibly damaging 0.59
R5121:Tex15 UTSW 8 33571766 missense probably damaging 1.00
R5147:Tex15 UTSW 8 33572312 nonsense probably null
R5166:Tex15 UTSW 8 33576392 missense probably benign 0.07
R5173:Tex15 UTSW 8 33571740 missense possibly damaging 0.73
R5439:Tex15 UTSW 8 33574171 missense possibly damaging 0.93
R5537:Tex15 UTSW 8 33571613 missense probably damaging 1.00
R5580:Tex15 UTSW 8 33572429 missense probably damaging 1.00
R5588:Tex15 UTSW 8 33577187 missense probably damaging 1.00
R5696:Tex15 UTSW 8 33573192 missense probably benign 0.01
R5734:Tex15 UTSW 8 33546336 missense probably benign 0.01
R5756:Tex15 UTSW 8 33575833 missense probably benign 0.17
R5823:Tex15 UTSW 8 33570934 missense possibly damaging 0.67
R6126:Tex15 UTSW 8 33573563 missense probably benign 0.19
R6129:Tex15 UTSW 8 33574130 missense possibly damaging 0.90
R6276:Tex15 UTSW 8 33577189 missense possibly damaging 0.93
R6374:Tex15 UTSW 8 33575912 missense probably damaging 1.00
R6430:Tex15 UTSW 8 33571301 missense probably benign 0.01
R6452:Tex15 UTSW 8 33572816 missense probably damaging 1.00
R6471:Tex15 UTSW 8 33581734 missense probably damaging 1.00
R6700:Tex15 UTSW 8 33574889 missense possibly damaging 0.93
R6918:Tex15 UTSW 8 33573184 missense probably benign 0.27
R6958:Tex15 UTSW 8 33570871 missense probably benign 0.01
R6970:Tex15 UTSW 8 33557428 missense probably benign 0.03
X0020:Tex15 UTSW 8 33576579 missense probably benign 0.03
X0065:Tex15 UTSW 8 33575517 nonsense probably null
Z1088:Tex15 UTSW 8 33571315 missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 33571810 missense possibly damaging 0.68
Z1088:Tex15 UTSW 8 33574870 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCATTGTGGGAAATGAAAGCTC -3'
(R):5'- GTCTCCATAGGAACTGTACACTTTTC -3'

Sequencing Primer
(F):5'- GGGAAATGAAAGCTCTTCTGAACTTG -3'
(R):5'- TCTATAGGAAAAATTGCTTCTCCAC -3'
Posted On2016-04-27