Incidental Mutation 'R4967:Hcn4'
ID384127
Institutional Source Beutler Lab
Gene Symbol Hcn4
Ensembl Gene ENSMUSG00000032338
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 4
Synonyms
MMRRC Submission 042563-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4967 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58823412-58863175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 58859828 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 891 (P891A)
Ref Sequence ENSEMBL: ENSMUSP00000034889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034889]
Predicted Effect unknown
Transcript: ENSMUST00000034889
AA Change: P891A
SMART Domains Protein: ENSMUSP00000034889
Gene: ENSMUSG00000032338
AA Change: P891A

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 97 120 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
Pfam:Ion_trans_N 218 261 1.2e-23 PFAM
Pfam:Ion_trans 262 525 2.2e-25 PFAM
low complexity region 526 537 N/A INTRINSIC
Blast:cNMP 538 570 9e-13 BLAST
cNMP 595 708 2.27e-23 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 808 818 N/A INTRINSIC
low complexity region 831 856 N/A INTRINSIC
low complexity region 866 906 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 931 956 N/A INTRINSIC
low complexity region 960 987 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
low complexity region 1021 1036 N/A INTRINSIC
low complexity region 1045 1073 N/A INTRINSIC
low complexity region 1123 1140 N/A INTRINSIC
low complexity region 1154 1164 N/A INTRINSIC
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hyperpolarization-activated cyclic nucleotide-gated potassium channels. The encoded protein shows slow kinetics of activation and inactivation, and is necessary for the cardiac pacemaking process. This channel may also mediate responses to sour stimuli. Mutations in this gene have been linked to sick sinus syndrome 2, also known as atrial fibrillation with bradyarrhythmia or familial sinus bradycardia. Two pseudogenes have been identified on chromosome 15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience embryonic lethality between E9.5 and E11.5. Conditional deletion in cardiac tissue results in severe bradycardia and death. Mice over-expressing the gene exhibit impaired firing rate in ORN, small olfactory bulb and reduced glomeruli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,728 Y199* probably null Het
Adhfe1 A T 1: 9,566,804 I394F probably benign Het
Arhgap26 G T 18: 39,246,840 R485L probably damaging Het
Atat1 T A 17: 35,901,575 N231I probably damaging Het
B4galnt2 T C 11: 95,869,274 N309S probably benign Het
Bank1 A T 3: 136,066,373 F499I probably damaging Het
Bcl9l A G 9: 44,505,068 D146G possibly damaging Het
Bglap3 A T 3: 88,376,364 probably benign Het
Bscl2 C A 19: 8,847,980 T376K probably benign Het
C87499 T C 4: 88,629,195 T80A probably damaging Het
Cercam A T 2: 29,871,021 probably null Het
Clec4f C T 6: 83,656,030 M1I probably null Het
Clec4n A T 6: 123,232,107 I14F probably benign Het
Cmya5 T C 13: 93,090,585 E2665G probably damaging Het
Cog4 T A 8: 110,852,283 probably null Het
Cubn A G 2: 13,348,045 F1961L probably benign Het
Cyp4a29 A T 4: 115,246,999 H88L probably benign Het
Dhdh A G 7: 45,479,106 L216P probably damaging Het
Dpp6 T C 5: 27,666,511 F544S probably damaging Het
Dthd1 C T 5: 62,888,206 T771I probably benign Het
Dusp27 A T 1: 166,127,106 V25E probably damaging Het
Emc10 A G 7: 44,493,188 probably null Het
Fam198a C T 9: 121,965,718 R313W probably damaging Het
Fgg A T 3: 83,012,765 T284S probably benign Het
Gm3002 T A 14: 3,824,737 N24K probably damaging Het
Gm8674 G A 13: 49,901,998 noncoding transcript Het
Gpr63 G A 4: 25,008,368 W364* probably null Het
Hcrtr1 A T 4: 130,130,999 F365I possibly damaging Het
Hmcn2 A G 2: 31,354,164 probably null Het
Hoxc5 T A 15: 103,015,354 L194H probably damaging Het
Ifna11 A G 4: 88,820,050 N31S probably null Het
Ikbke GCC G 1: 131,275,267 probably null Het
Iqgap2 A T 13: 95,630,006 D1496E probably benign Het
Kif28 G T 1: 179,708,442 Q556K probably damaging Het
Klhl42 C T 6: 147,108,004 T447I possibly damaging Het
Lrp1b A C 2: 41,788,974 D35E probably damaging Het
Lsm14b A G 2: 180,033,899 probably benign Het
Map3k1 T C 13: 111,772,738 E226G probably damaging Het
Map3k14 T A 11: 103,239,531 N187Y probably benign Het
Mcm6 A T 1: 128,335,849 V645E probably damaging Het
Mdh1b G T 1: 63,719,863 P190Q probably damaging Het
Meiob T G 17: 24,818,379 L77R probably damaging Het
Mkl1 C A 15: 81,045,275 probably benign Het
Mrgpra3 A T 7: 47,589,519 F220I probably benign Het
Mtor T A 4: 148,491,360 S1324T possibly damaging Het
Myot T A 18: 44,354,928 D437E possibly damaging Het
Ncoa6 G T 2: 155,421,332 T394K possibly damaging Het
Nf1 T A 11: 79,565,553 probably null Het
Nup210 T A 6: 91,036,469 T1190S possibly damaging Het
Odf1 T A 15: 38,226,408 I184N probably damaging Het
Olfr178 G T 16: 58,889,594 Q209K possibly damaging Het
Olfr270 T C 4: 52,970,960 V113A possibly damaging Het
Olfr353 A G 2: 36,890,707 I47T probably damaging Het
Olfr959 C T 9: 39,572,758 C167Y probably damaging Het
Padi1 A G 4: 140,845,590 V21A probably benign Het
Pdzrn3 C T 6: 101,151,590 R705H probably damaging Het
Pik3cb T C 9: 99,105,632 I18V probably benign Het
Pmpca T C 2: 26,390,308 S117P probably damaging Het
Poteg T A 8: 27,494,981 probably benign Het
Rab30 G A 7: 92,829,563 R72H probably damaging Het
Ramp2 T A 11: 101,247,557 probably null Het
Rbks G A 5: 31,624,532 T308I probably damaging Het
Rnf112 A G 11: 61,452,926 probably benign Het
Rnf38 G A 4: 44,152,460 P3S probably damaging Het
Sec16a A G 2: 26,412,871 S2344P probably benign Het
Slc16a8 C T 15: 79,252,884 V109M possibly damaging Het
Slc28a1 A T 7: 81,142,009 T308S possibly damaging Het
Slc39a3 T C 10: 81,031,619 T98A possibly damaging Het
Smarcc2 T C 10: 128,483,180 F731L probably damaging Het
Smc4 A G 3: 69,018,239 probably benign Het
Sparcl1 T G 5: 104,092,910 D216A probably damaging Het
Speg G A 1: 75,387,869 R192H probably damaging Het
Sspo T C 6: 48,464,605 L1892P probably damaging Het
Tacc2 A G 7: 130,623,948 N807D probably damaging Het
Teddm1a A T 1: 153,892,233 K148* probably null Het
Tex15 T A 8: 33,574,470 D1309E probably benign Het
Thbs1 A T 2: 118,114,778 E277D probably benign Het
Ticrr G A 7: 79,660,410 R24Q probably damaging Het
Tigd4 A G 3: 84,595,153 E459G probably benign Het
Tln2 C A 9: 67,355,125 A615S probably damaging Het
Tmprss5 T C 9: 49,115,517 V410A probably damaging Het
Tnrc6a G T 7: 123,189,872 W1638L probably damaging Het
Tpr A G 1: 150,410,059 D424G probably damaging Het
Trim34a A T 7: 104,261,064 K358* probably null Het
Tssk5 T A 15: 76,374,656 D10V possibly damaging Het
Usp35 A C 7: 97,313,575 L470R probably damaging Het
Usp42 T C 5: 143,715,364 D968G possibly damaging Het
Utrn A G 10: 12,455,420 V2924A probably damaging Het
Wdtc1 C A 4: 133,294,343 A627S probably damaging Het
Xrra1 A G 7: 99,906,523 T366A probably damaging Het
Zfp712 T A 13: 67,040,709 K585* probably null Het
Zfp97 T A 17: 17,145,131 N297K probably damaging Het
Zfp97 G T 17: 17,144,676 E146* probably null Het
Other mutations in Hcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hcn4 APN 9 58860053 missense unknown
IGL00939:Hcn4 APN 9 58843927 missense probably benign 0.39
IGL01154:Hcn4 APN 9 58859079 missense unknown
IGL01408:Hcn4 APN 9 58859886 missense unknown
IGL02658:Hcn4 APN 9 58859465 missense unknown
IGL02877:Hcn4 APN 9 58859167 missense unknown
IGL03211:Hcn4 APN 9 58858151 missense unknown
PIT1430001:Hcn4 UTSW 9 58859550 missense unknown
R0049:Hcn4 UTSW 9 58860299 missense probably damaging 0.98
R0268:Hcn4 UTSW 9 58860162 missense unknown
R0812:Hcn4 UTSW 9 58823512 start codon destroyed probably null
R2121:Hcn4 UTSW 9 58824058 missense unknown
R3035:Hcn4 UTSW 9 58823680 missense unknown
R3715:Hcn4 UTSW 9 58844036 missense unknown
R3737:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R3958:Hcn4 UTSW 9 58844048 missense unknown
R4035:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R4393:Hcn4 UTSW 9 58844300 missense unknown
R4418:Hcn4 UTSW 9 58843895 missense probably benign 0.39
R4532:Hcn4 UTSW 9 58857798 missense unknown
R4765:Hcn4 UTSW 9 58857977 missense unknown
R4857:Hcn4 UTSW 9 58859570 missense unknown
R5068:Hcn4 UTSW 9 58860021 missense unknown
R5253:Hcn4 UTSW 9 58824275 missense unknown
R5304:Hcn4 UTSW 9 58843932 missense probably benign 0.39
R5600:Hcn4 UTSW 9 58859293 splice site probably null
R6346:Hcn4 UTSW 9 58859044 missense unknown
R6575:Hcn4 UTSW 9 58824152 missense unknown
R6622:Hcn4 UTSW 9 58857727 missense unknown
R6967:Hcn4 UTSW 9 58823945 missense unknown
X0009:Hcn4 UTSW 9 58860759 nonsense probably null
X0057:Hcn4 UTSW 9 58859368 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGATCCCTTCAGCTCTGGG -3'
(R):5'- AGACCTAGGGACAACTCTCC -3'

Sequencing Primer
(F):5'- TGGGCTCTGCTTCACCCG -3'
(R):5'- CAAGAAGTGCTCCAGGAGTCC -3'
Posted On2016-04-27