Incidental Mutation 'R4967:Mkl1'
ID384150
Institutional Source Beutler Lab
Gene Symbol Mkl1
Ensembl Gene ENSMUSG00000042292
Gene NameMKL (megakaryoblastic leukemia)/myocardin-like 1
SynonymsMal, MRTF-A, Bsac
MMRRC Submission 042563-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R4967 (G1)
Quality Score172
Status Validated
Chromosome15
Chromosomal Location81012281-81190757 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 81045275 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000135047] [ENSMUST00000149582]
Predicted Effect probably benign
Transcript: ENSMUST00000109579
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123243
Predicted Effect probably benign
Transcript: ENSMUST00000131235
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134469
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135047
SMART Domains Protein: ENSMUSP00000118451
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147921
Predicted Effect probably benign
Transcript: ENSMUST00000149582
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the transcription factor myocardin, a key regulator of smooth muscle cell differentiation. The encoded protein is predominantly nuclear and may help transduce signals from the cytoskeleton to the nucleus. This gene is involved in a specific translocation event that creates a fusion of this gene and the RNA-binding motif protein-15 gene. This translocation has been associated with acute megakaryocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired mammary myoepithelial cell differentiation and fail to eject milk and productively nurse their offspring. Mice homozygous for another null allele show partial embryonic lethality caused by myocardial necrosis as well as mammary gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,728 Y199* probably null Het
Adhfe1 A T 1: 9,566,804 I394F probably benign Het
Arhgap26 G T 18: 39,246,840 R485L probably damaging Het
Atat1 T A 17: 35,901,575 N231I probably damaging Het
B4galnt2 T C 11: 95,869,274 N309S probably benign Het
Bank1 A T 3: 136,066,373 F499I probably damaging Het
Bcl9l A G 9: 44,505,068 D146G possibly damaging Het
Bglap3 A T 3: 88,376,364 probably benign Het
Bscl2 C A 19: 8,847,980 T376K probably benign Het
C87499 T C 4: 88,629,195 T80A probably damaging Het
Cercam A T 2: 29,871,021 probably null Het
Clec4f C T 6: 83,656,030 M1I probably null Het
Clec4n A T 6: 123,232,107 I14F probably benign Het
Cmya5 T C 13: 93,090,585 E2665G probably damaging Het
Cog4 T A 8: 110,852,283 probably null Het
Cubn A G 2: 13,348,045 F1961L probably benign Het
Cyp4a29 A T 4: 115,246,999 H88L probably benign Het
Dhdh A G 7: 45,479,106 L216P probably damaging Het
Dpp6 T C 5: 27,666,511 F544S probably damaging Het
Dthd1 C T 5: 62,888,206 T771I probably benign Het
Dusp27 A T 1: 166,127,106 V25E probably damaging Het
Emc10 A G 7: 44,493,188 probably null Het
Fam198a C T 9: 121,965,718 R313W probably damaging Het
Fgg A T 3: 83,012,765 T284S probably benign Het
Gm3002 T A 14: 3,824,737 N24K probably damaging Het
Gm8674 G A 13: 49,901,998 noncoding transcript Het
Gpr63 G A 4: 25,008,368 W364* probably null Het
Hcn4 C G 9: 58,859,828 P891A unknown Het
Hcrtr1 A T 4: 130,130,999 F365I possibly damaging Het
Hmcn2 A G 2: 31,354,164 probably null Het
Hoxc5 T A 15: 103,015,354 L194H probably damaging Het
Ifna11 A G 4: 88,820,050 N31S probably null Het
Ikbke GCC G 1: 131,275,267 probably null Het
Iqgap2 A T 13: 95,630,006 D1496E probably benign Het
Kif28 G T 1: 179,708,442 Q556K probably damaging Het
Klhl42 C T 6: 147,108,004 T447I possibly damaging Het
Lrp1b A C 2: 41,788,974 D35E probably damaging Het
Lsm14b A G 2: 180,033,899 probably benign Het
Map3k1 T C 13: 111,772,738 E226G probably damaging Het
Map3k14 T A 11: 103,239,531 N187Y probably benign Het
Mcm6 A T 1: 128,335,849 V645E probably damaging Het
Mdh1b G T 1: 63,719,863 P190Q probably damaging Het
Meiob T G 17: 24,818,379 L77R probably damaging Het
Mrgpra3 A T 7: 47,589,519 F220I probably benign Het
Mtor T A 4: 148,491,360 S1324T possibly damaging Het
Myot T A 18: 44,354,928 D437E possibly damaging Het
Ncoa6 G T 2: 155,421,332 T394K possibly damaging Het
Nf1 T A 11: 79,565,553 probably null Het
Nup210 T A 6: 91,036,469 T1190S possibly damaging Het
Odf1 T A 15: 38,226,408 I184N probably damaging Het
Olfr178 G T 16: 58,889,594 Q209K possibly damaging Het
Olfr270 T C 4: 52,970,960 V113A possibly damaging Het
Olfr353 A G 2: 36,890,707 I47T probably damaging Het
Olfr959 C T 9: 39,572,758 C167Y probably damaging Het
Padi1 A G 4: 140,845,590 V21A probably benign Het
Pdzrn3 C T 6: 101,151,590 R705H probably damaging Het
Pik3cb T C 9: 99,105,632 I18V probably benign Het
Pmpca T C 2: 26,390,308 S117P probably damaging Het
Poteg T A 8: 27,494,981 probably benign Het
Rab30 G A 7: 92,829,563 R72H probably damaging Het
Ramp2 T A 11: 101,247,557 probably null Het
Rbks G A 5: 31,624,532 T308I probably damaging Het
Rnf112 A G 11: 61,452,926 probably benign Het
Rnf38 G A 4: 44,152,460 P3S probably damaging Het
Sec16a A G 2: 26,412,871 S2344P probably benign Het
Slc16a8 C T 15: 79,252,884 V109M possibly damaging Het
Slc28a1 A T 7: 81,142,009 T308S possibly damaging Het
Slc39a3 T C 10: 81,031,619 T98A possibly damaging Het
Smarcc2 T C 10: 128,483,180 F731L probably damaging Het
Smc4 A G 3: 69,018,239 probably benign Het
Sparcl1 T G 5: 104,092,910 D216A probably damaging Het
Speg G A 1: 75,387,869 R192H probably damaging Het
Sspo T C 6: 48,464,605 L1892P probably damaging Het
Tacc2 A G 7: 130,623,948 N807D probably damaging Het
Teddm1a A T 1: 153,892,233 K148* probably null Het
Tex15 T A 8: 33,574,470 D1309E probably benign Het
Thbs1 A T 2: 118,114,778 E277D probably benign Het
Ticrr G A 7: 79,660,410 R24Q probably damaging Het
Tigd4 A G 3: 84,595,153 E459G probably benign Het
Tln2 C A 9: 67,355,125 A615S probably damaging Het
Tmprss5 T C 9: 49,115,517 V410A probably damaging Het
Tnrc6a G T 7: 123,189,872 W1638L probably damaging Het
Tpr A G 1: 150,410,059 D424G probably damaging Het
Trim34a A T 7: 104,261,064 K358* probably null Het
Tssk5 T A 15: 76,374,656 D10V possibly damaging Het
Usp35 A C 7: 97,313,575 L470R probably damaging Het
Usp42 T C 5: 143,715,364 D968G possibly damaging Het
Utrn A G 10: 12,455,420 V2924A probably damaging Het
Wdtc1 C A 4: 133,294,343 A627S probably damaging Het
Xrra1 A G 7: 99,906,523 T366A probably damaging Het
Zfp712 T A 13: 67,040,709 K585* probably null Het
Zfp97 T A 17: 17,145,131 N297K probably damaging Het
Zfp97 G T 17: 17,144,676 E146* probably null Het
Other mutations in Mkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Mkl1 APN 15 81016302 missense probably damaging 1.00
IGL02831:Mkl1 APN 15 81104793 missense probably benign 0.14
IGL03060:Mkl1 APN 15 81045322 missense probably damaging 1.00
R0594:Mkl1 UTSW 15 81017174 missense probably damaging 1.00
R0648:Mkl1 UTSW 15 81016920 missense probably damaging 1.00
R1085:Mkl1 UTSW 15 81020883 missense probably damaging 1.00
R1476:Mkl1 UTSW 15 81018208 splice site probably benign
R4030:Mkl1 UTSW 15 81015784 missense probably benign 0.01
R4232:Mkl1 UTSW 15 81023595 missense probably damaging 1.00
R4307:Mkl1 UTSW 15 81016347 missense possibly damaging 0.88
R4400:Mkl1 UTSW 15 81020923 nonsense probably null
R4795:Mkl1 UTSW 15 81017033 missense probably damaging 0.97
R4796:Mkl1 UTSW 15 81017033 missense probably damaging 0.97
R4801:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4802:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4899:Mkl1 UTSW 15 81018386 missense probably damaging 1.00
R5071:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5072:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5073:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5074:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R6186:Mkl1 UTSW 15 81016652 missense probably damaging 1.00
R6512:Mkl1 UTSW 15 81013716 missense probably benign
R6581:Mkl1 UTSW 15 81016373 missense probably damaging 1.00
X0013:Mkl1 UTSW 15 81022436 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCACTGCTTGTTTCACTGAAC -3'
(R):5'- TACCCACAGTTGCAGTTTGGG -3'

Sequencing Primer
(F):5'- TCACTGAACATGATGAATCTGGGC -3'
(R):5'- CACAGTTGCAGTTTGGGATCCTC -3'
Posted On2016-04-27