Incidental Mutation 'R4967:Olfr178'
ID384152
Institutional Source Beutler Lab
Gene Symbol Olfr178
Ensembl Gene ENSMUSG00000044029
Gene Nameolfactory receptor 178
SynonymsGA_x54KRFPKG5P-55108059-55107100, MOR184-6
MMRRC Submission 042563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4967 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58888308-58892063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58889594 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 209 (Q209K)
Ref Sequence ENSEMBL: ENSMUSP00000148922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058564] [ENSMUST00000206523] [ENSMUST00000215032]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058564
AA Change: Q209K

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049578
Gene: ENSMUSG00000044029
AA Change: Q209K

DomainStartEndE-ValueType
Pfam:7tm_4 33 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 37 262 4.4e-7 PFAM
Pfam:7tm_1 43 312 5.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206523
AA Change: Q209K

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215032
AA Change: Q209K

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,728 Y199* probably null Het
Adhfe1 A T 1: 9,566,804 I394F probably benign Het
Arhgap26 G T 18: 39,246,840 R485L probably damaging Het
Atat1 T A 17: 35,901,575 N231I probably damaging Het
B4galnt2 T C 11: 95,869,274 N309S probably benign Het
Bank1 A T 3: 136,066,373 F499I probably damaging Het
Bcl9l A G 9: 44,505,068 D146G possibly damaging Het
Bglap3 A T 3: 88,376,364 probably benign Het
Bscl2 C A 19: 8,847,980 T376K probably benign Het
C87499 T C 4: 88,629,195 T80A probably damaging Het
Cercam A T 2: 29,871,021 probably null Het
Clec4f C T 6: 83,656,030 M1I probably null Het
Clec4n A T 6: 123,232,107 I14F probably benign Het
Cmya5 T C 13: 93,090,585 E2665G probably damaging Het
Cog4 T A 8: 110,852,283 probably null Het
Cubn A G 2: 13,348,045 F1961L probably benign Het
Cyp4a29 A T 4: 115,246,999 H88L probably benign Het
Dhdh A G 7: 45,479,106 L216P probably damaging Het
Dpp6 T C 5: 27,666,511 F544S probably damaging Het
Dthd1 C T 5: 62,888,206 T771I probably benign Het
Dusp27 A T 1: 166,127,106 V25E probably damaging Het
Emc10 A G 7: 44,493,188 probably null Het
Fam198a C T 9: 121,965,718 R313W probably damaging Het
Fgg A T 3: 83,012,765 T284S probably benign Het
Gm3002 T A 14: 3,824,737 N24K probably damaging Het
Gm8674 G A 13: 49,901,998 noncoding transcript Het
Gpr63 G A 4: 25,008,368 W364* probably null Het
Hcn4 C G 9: 58,859,828 P891A unknown Het
Hcrtr1 A T 4: 130,130,999 F365I possibly damaging Het
Hmcn2 A G 2: 31,354,164 probably null Het
Hoxc5 T A 15: 103,015,354 L194H probably damaging Het
Ifna11 A G 4: 88,820,050 N31S probably null Het
Ikbke GCC G 1: 131,275,267 probably null Het
Iqgap2 A T 13: 95,630,006 D1496E probably benign Het
Kif28 G T 1: 179,708,442 Q556K probably damaging Het
Klhl42 C T 6: 147,108,004 T447I possibly damaging Het
Lrp1b A C 2: 41,788,974 D35E probably damaging Het
Lsm14b A G 2: 180,033,899 probably benign Het
Map3k1 T C 13: 111,772,738 E226G probably damaging Het
Map3k14 T A 11: 103,239,531 N187Y probably benign Het
Mcm6 A T 1: 128,335,849 V645E probably damaging Het
Mdh1b G T 1: 63,719,863 P190Q probably damaging Het
Meiob T G 17: 24,818,379 L77R probably damaging Het
Mkl1 C A 15: 81,045,275 probably benign Het
Mrgpra3 A T 7: 47,589,519 F220I probably benign Het
Mtor T A 4: 148,491,360 S1324T possibly damaging Het
Myot T A 18: 44,354,928 D437E possibly damaging Het
Ncoa6 G T 2: 155,421,332 T394K possibly damaging Het
Nf1 T A 11: 79,565,553 probably null Het
Nup210 T A 6: 91,036,469 T1190S possibly damaging Het
Odf1 T A 15: 38,226,408 I184N probably damaging Het
Olfr270 T C 4: 52,970,960 V113A possibly damaging Het
Olfr353 A G 2: 36,890,707 I47T probably damaging Het
Olfr959 C T 9: 39,572,758 C167Y probably damaging Het
Padi1 A G 4: 140,845,590 V21A probably benign Het
Pdzrn3 C T 6: 101,151,590 R705H probably damaging Het
Pik3cb T C 9: 99,105,632 I18V probably benign Het
Pmpca T C 2: 26,390,308 S117P probably damaging Het
Poteg T A 8: 27,494,981 probably benign Het
Rab30 G A 7: 92,829,563 R72H probably damaging Het
Ramp2 T A 11: 101,247,557 probably null Het
Rbks G A 5: 31,624,532 T308I probably damaging Het
Rnf112 A G 11: 61,452,926 probably benign Het
Rnf38 G A 4: 44,152,460 P3S probably damaging Het
Sec16a A G 2: 26,412,871 S2344P probably benign Het
Slc16a8 C T 15: 79,252,884 V109M possibly damaging Het
Slc28a1 A T 7: 81,142,009 T308S possibly damaging Het
Slc39a3 T C 10: 81,031,619 T98A possibly damaging Het
Smarcc2 T C 10: 128,483,180 F731L probably damaging Het
Smc4 A G 3: 69,018,239 probably benign Het
Sparcl1 T G 5: 104,092,910 D216A probably damaging Het
Speg G A 1: 75,387,869 R192H probably damaging Het
Sspo T C 6: 48,464,605 L1892P probably damaging Het
Tacc2 A G 7: 130,623,948 N807D probably damaging Het
Teddm1a A T 1: 153,892,233 K148* probably null Het
Tex15 T A 8: 33,574,470 D1309E probably benign Het
Thbs1 A T 2: 118,114,778 E277D probably benign Het
Ticrr G A 7: 79,660,410 R24Q probably damaging Het
Tigd4 A G 3: 84,595,153 E459G probably benign Het
Tln2 C A 9: 67,355,125 A615S probably damaging Het
Tmprss5 T C 9: 49,115,517 V410A probably damaging Het
Tnrc6a G T 7: 123,189,872 W1638L probably damaging Het
Tpr A G 1: 150,410,059 D424G probably damaging Het
Trim34a A T 7: 104,261,064 K358* probably null Het
Tssk5 T A 15: 76,374,656 D10V possibly damaging Het
Usp35 A C 7: 97,313,575 L470R probably damaging Het
Usp42 T C 5: 143,715,364 D968G possibly damaging Het
Utrn A G 10: 12,455,420 V2924A probably damaging Het
Wdtc1 C A 4: 133,294,343 A627S probably damaging Het
Xrra1 A G 7: 99,906,523 T366A probably damaging Het
Zfp712 T A 13: 67,040,709 K585* probably null Het
Zfp97 T A 17: 17,145,131 N297K probably damaging Het
Zfp97 G T 17: 17,144,676 E146* probably null Het
Other mutations in Olfr178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr178 APN 16 58889685 missense probably damaging 0.97
IGL01964:Olfr178 APN 16 58889464 missense probably damaging 0.97
IGL02122:Olfr178 APN 16 58889771 missense probably benign
IGL02183:Olfr178 APN 16 58889821 missense probably benign 0.00
IGL03143:Olfr178 APN 16 58889461 missense probably damaging 1.00
R1566:Olfr178 UTSW 16 58889540 missense probably damaging 1.00
R2324:Olfr178 UTSW 16 58890140 missense probably benign
R2420:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R2421:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R2422:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R4256:Olfr178 UTSW 16 58889780 missense probably benign 0.21
R4374:Olfr178 UTSW 16 58889879 missense probably benign 0.13
R4502:Olfr178 UTSW 16 58890176 missense probably benign 0.02
R4503:Olfr178 UTSW 16 58890176 missense probably benign 0.02
R4662:Olfr178 UTSW 16 58889924 missense probably damaging 1.00
R5206:Olfr178 UTSW 16 58890018 missense probably damaging 0.99
R5285:Olfr178 UTSW 16 58890108 nonsense probably null
R5477:Olfr178 UTSW 16 58889744 missense probably benign 0.10
R5554:Olfr178 UTSW 16 58889806 missense possibly damaging 0.95
R5723:Olfr178 UTSW 16 58889613 nonsense probably null
R5725:Olfr178 UTSW 16 58889887 missense possibly damaging 0.64
R6853:Olfr178 UTSW 16 58889758 missense possibly damaging 0.64
R6853:Olfr178 UTSW 16 58889759 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCACTGGTATGTCTTTATTACTG -3'
(R):5'- TCCAAGAAACTCTCCATTCAGATG -3'

Sequencing Primer
(F):5'- GCACAGGTAGAAAGTGCT -3'
(R):5'- CTCTCCATTCAGATGAGTATAGGCAC -3'
Posted On2016-04-27