Incidental Mutation 'R4969:Slc9a8'
ID384249
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms1200006P13Rik, 6430709P13Rik, NHE8
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location167421712-167477000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 167446529 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 183 (T183A)
Ref Sequence ENSEMBL: ENSMUSP00000044185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
Predicted Effect probably benign
Transcript: ENSMUST00000047815
AA Change: T183A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: T183A

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073873
AA Change: T156A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: T156A

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109218
AA Change: T156A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: T156A

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155585
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167424166 missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167467677 splice site probably benign
costello UTSW 2 167451296 missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167451296 missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167457344 missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167424205 missense probably benign
R0906:Slc9a8 UTSW 2 167434867 intron probably benign
R1216:Slc9a8 UTSW 2 167424121 missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167471523 missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167471432 missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167471465 missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167457358 missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167424214 missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167451276 missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167451281 missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167457352 missense probably benign
R3757:Slc9a8 UTSW 2 167424130 missense probably benign 0.01
R4499:Slc9a8 UTSW 2 167424193 missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167441170 nonsense probably null
R4904:Slc9a8 UTSW 2 167471396 missense possibly damaging 0.51
R5395:Slc9a8 UTSW 2 167467722 missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167471387 nonsense probably null
R5908:Slc9a8 UTSW 2 167451170 intron probably benign
R6311:Slc9a8 UTSW 2 167451220 missense probably damaging 1.00
R6443:Slc9a8 UTSW 2 167434821 missense probably benign 0.00
R6494:Slc9a8 UTSW 2 167424291 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCCCACATGTGCTCAC -3'
(R):5'- TCAGCAATGTTATGATCAGGGG -3'

Sequencing Primer
(F):5'- GCTCACAGCAGCCCTTG -3'
(R):5'- TGTTATGATCAGGGGTCTTTAAAAG -3'
Posted On2016-04-27